Description :
From Genome Similarity Track
Location :
Scaffold_3:4363291- 4365850
Transcript NameFunction/comments
Physo_560616protein phosphatase PP2A regulatory subunit B

Sequence
2559 bases(100 bases per row)
TAGCGAAGACTTCGAAGAACCAATTTGTTGTTGATATACTTGTTGTGATATTTCCCTCGATACACTTCCGCAATACTCGAACACTTCCAATGACAAATAT
CGTGTTTGTGGTTGGATTCATTCGAGATCGCGCTTCAGCAGCTTCCCCACTCAATGTCTGGTGCTGTGTTCTCTTACCGCTGGAGATTCCCATGATTTTT
TTTTTCGCGACACCGTATCCGAAGCACTTACGAAGCATATACGAAGAGGCTGTTGCGGATGGAGACGGCCACCTCGTTCAGTGACGGGTGCCAGCTGGTC
TGCAAGATCTTCTTCGAGAAATCCAACGCGTCTGGGTCGCCGGGAGCGGGCATTGCGGCGATCTGATGCGCGAGGCCTCGCTGCGGCATTGAGTGGCGAC
GACTCACACGCGCGGTGCGCGGGGTGATCGAAATGTCGGCGCGCCCATAGCGGTCATAAATATGGAACTCGCTGTTGTACGAGCCCGTGATGAAGTTGTT
GCCGTCCCCGCCAACCGCGCACTCGAACTTGTCGAAGATACAGTCGCTCTCGTACAGATCTCCCAACCGTGGACGAAGGTGTTCGTGAATCTAACCACAA
AAGATAATACGTGACTCACTCAAGAAAACGCAAAATGCAAATACCCCGACAACTTACGTTGATTGTTTGGACAGGACGCGAGTTCATGTTAATGTCCCAG
ACTTTCAATGTTAGGAAGTCGCGCGCAATAATGTAGCGACCGTCCGGAGAAAACTTGATGTCCGAGATGGAGGCAATGATTTCAGAGAAGAAGCTTCGTG
CCTCGGGGTCCTCCTGCTCTTCAAACACTGCTTTCCATCGAGTTAGTGCGAACTGAGCAAGGCCACAGCAATACACAAAACGTGCTCTGGGCGATGCGTA
CCTTGGGAGTACGAGTCGCACAGCGCTGCCTGGCGCATGTCCCCAAGCTTGATGGACCCGCGACTTGTGCTGTACATCATCGTGTTGCAGTGTGTTGGGT
GGAAGTCCGCAGCCGTGATAACCTCCGTGAGCTCCTCCATGTTCGCTGGCTTGATGTCCACAATGTCTATCCACATTTGTACAGTATGGAAATGATTGGG
TTAGCTTGCATCTTGCACATTCGGTAGGAAACAGCCTCAACAACGTACTGAAGCTTTGGTCCGAGTTTCCTAAACTCCAGAGGTTCACGCGCAGGTCGTC
CGCCGACATGAATGTCTCTCCGTCGCTGTTGATCGCGATCGAGTTGATGTGGTACGTGTGCGCGTTCGCGTAGACGCGCTTTGCGGTGGATGTTGTCACG
TGGCCGCGGACATGCGTTTGCGGCAGACGAATGAGTGCCGGCGTAATATTCGCCCGCGGGACGTGGGCGAGGCCTTGCTCGTTGAACGTCGTGACCTCAC
GCACACTGCGCTCGTGGATCTTCCACAGTTTGATGGTCTTATCATTCGTAGACAGTAAGCACTGGGACCCGTTGGACGGTCGGCACCACTTGATCTGGTT
GATTTTCTCCTCGATCTCGAGGCTCTTGAGGTAGTCGAACTCGGCGTTGTGGCTCTGGAACTCGGTGTAGAGCTGGTACTGCGGGTCATTGGAGCCGCTG
CTAAACATGCTCTGGTTCTAATTTACGAGAAGACGGTTAGAAGACAGTCTGCGATCCAATACATCAACCAACAGCCGCGACTGACCGATGCTGGATTCCC
GTGGCGGCAGTAGATGGAGACGCGGCCGCCTTTGTTGCCTGTGGCGAGGAAGTCTCCCGAGCGGTCGTACTCGATGGCGGAGATCACCTCGGCTGCATCA
ACCACCACCATCAAGATGTGCACTCAATAACCCGTTTGTTTGACTCCTGCAATGCGGCGGTCTAGATCCCTTACCTTCCACGAAGCTGCGGGCGCTCTCC
CCGGCCGAGAAGACCTGCCCCCACTCGGCGTCGGCCTCGTTGGTCGAGGGTTCGGCCATGTTGACCTCGAGCCCAGCGGTCGTGTTGTGCTTGAGCCTGG
TGAGCGCTCCCACGCGGGTCTCTTCTCCTGCTGCTGCGACGTCCATAGCTTGCGTCATACAGAAACGCGGGGGTGCCCTGCTGGCCTGGAAACAAGATCT
CTCGCTGGAGGTGGCGGCGCTGCTGTCGACGACGACTCGTCCGGGGATCGGGCGCTGCTCTCTCTCCTTCTCCCGCTCTCTCGGAGGATCTCGGTCTCCG
TCGGTGGTTTCGCGCAGAGGCGGAGGGGGGGGTTTCGTTTCTCGGGTGTCTGCAGACGGGCAGAGGCGCGACCACTTAGGAATGGGCGGCAAGCGGGGGA
TTGAGGCGACGGCGTTTCAAGGCGCGCAAATCCACGCGGCACAGGCTGAAGCACGCGCGGGCTCTACGGCGGCAGTGCAGTGCGGTGGCCGACGGGCAGG
CAGCGAGGCGAGTGCGCGGCCTGCAAGATGATCGCAATGACTCGGCCGGACCAGACGATCGCGATCTTCAATCGCATTTTTGTTCGCTTGGCCAATCGCG
GCGAGTGAAGCCACTGCGATTTCCGCCAATCAGCAAGCGATCACGCAAAAATCGAAGCA