Description :
From Genome Similarity Track
Location :
Scaffold_1372:4363- 6428
Transcript NameFunction/comments
Phyag_g10433ABC transporter ABCA1 lipid exporter family

Sequence
2065 bases(100 bases per row)
GGTGAACAACCACCCGCTGCCattgacggcggcggcgaagGCACTTTTCGGCTCATTCTTGGCATTCAGTGCCtgcgtcttcgtctgcaTCTCGTTCTCG
TACTTCTCGCTACCTGTTGTGGTGTATCTGGTGagggagaaggaggcgaatCACAACtcgaagcaccagcagctaGTATCTGGAGTTTCGCTGACAGCGT
TTTGGCTCGCAAACTACCTATGGGACCTCATAATGTACATCGTACCATGCGTCGCTGGTATCATCCTGATCAAGGCCTTTGACATTTCAGCTCTGACTGG
AAATTCCGAatgcacgagctgcacgtccGAGACGTTTCCAGCGGTGATTGTGCTGTTCATTCTCTTCGGAATCGCGATTTGCCCGTTCACCTACTGCTTG
TCGTTCCTGTTCAAGGAACACGCGGCATCGCAAACTTTCACGATGAAACTCAACTTCTTGCTTGGCGTGGTGCTAATGATCGTCTCATATATCCTCGACG
TCATTGATTCGACCAAGAGTGTGAATTCGGTGCTCAAGTACATCTGGAGACTGTCGCCGCTTTTCGACCTGGGGAACGGTTTGCTGTCACTGGTTTTGAA
CGAACTCGATGCGCTACAGGACGGCACAACAAAAAAGAAGAGTCCATTCAGCACTGATCTAGTGGGCGCTGAGTTGATCTTCCTCGTGATCACGACGTTC
CTCTTTTCGGCTGTGGTGTTGGCGATCGACTACGATGTGAAATTTCCAGGTTTCGGACGCAAGAGCGCAAGTGCTCAAGGCATCGAAGACGGAAAATTTG
ATATCGACGAAGATGTTGCGAGGGAGGCCCAGCGAGTTGTTAACGGTGAAGCCAACGATGATGCAGTGAAGATTGCGGGGCTGCGGAAAGTGTATCCGGG
TGGGAAGGTGGCAGTTCGGGACCTCTCCTTTGGCTTGCAGCGTGGCGAGTGCTTCGGTTTCCTCGGAATCAACGGTGCTGGTAAGACCACCACGATGAAA
ATGCTCACGGGTGATGTCACACCGACTTGTGGAACCGCCACACTCGGAGGCTTCGACAtcttgacgcagcagatcgaaGTGCGCCGCCAAATTGGCTACT
GCCCGCAGTTTGATGCCTTGTTCGAGCAGATGACTGTGCGCGAGCATTTGGAGCTGTTCGCGGCGATCAAGGGCGTGTCACGAGTCGACATGGATATCGT
CGTGACCGAGAAAATTCAACAGCTCAACCTCGCAGACTTTGAACACAAGTTGGCAGGCAGCCTCAGCGGTGGCAATAAGCGCAAGTTGTCTGTGGCCATC
GCATTGATCGGCAGCCCGCCCATTATTTTCTTGGATGAGCCATCCACCGGCATGGACCCGGTGTCTCGACGCTTCATGTGGGACGTCATCGCCGATATCT
CCACCCGAGGCAAGGAATCCACGATCGTTTTGACGACGCATAGTATGGAGGAGTGTGAAGCACTGTGTTCACGAGTAGGCATCATGGTGGGCGGACGTCT
TCGTTGCTACGGAAGCGTTCAACATCTCAAGTCTCGATTCGGCGATGGTCTCGTGTTCGACACCAAGTTTGAGGCCGTGTCGGCAGATGAGCTCGATGGT
CTGCTTCAGAAGGTGTGCGGTGACGGCAACGCCTTTGTCACGCCGGCAGATGTGGAAGATAAGTGCCGCGCATTTGGCAACGTCGAGTTGGCAAAGCGTG
TGAAGGCGTCGCACCCGACGGGTTATAGTCTTGCAGCTGCTATGGAACGCGACGGGTTTGCTCGCGCGGAGGCATTCTGCGCGTGGTGCGTGGAGGAGAC
GCGTTTTGACGCTCTGAACGAGTACCTCCAGCAAGCCTTTGGTGCCAACAGCATTGTTGTGTTGGAGAGGCAGAATGACTTCTGCCGCTTCAAGGTGCGA
AGCGGTCACGGCGATGTGAAGCTATCGAGGATGTTCGCGCTGGTCGAAGACATCAAAACCAAGATGCACATTCGCGAGTACAGCGTTTCGCAGACAACAC
TCGAGCAAATTTTCAACTCATTCGCAagccagcaagaagaagagcagggAGCTGTGCGAGGTGTG