Description :
From Genome Similarity Track
Location :
Scaffold_11:436255- 463671
Transcript NameFunction/comments
Phyra_94065exosome complex exonuclease RRP40, putative
Phyra_75171outer dynein arm-docking complex subunit 3
Phyra_75172voltagedependent anionselective channel protein puta
Phyra_75173voltagedependent anionselective channel protein puta
Phyra_94066Hypothetical protein
Phyra_94069ironsulfur cluster assembly protein putative
Phyra_94070Hypothetical protein
Phyra_75177Hypothetical protein
Phyra_75178Hypothetical protein
Phyra_75179ATPase family AAA domain-containing protein 5
Phyra_75180P18, putative
Phyra_75181predicted protein
Phyra_75182Hypothetical protein
Phyra_75183PREDICTED: uncharacterized protein LOC101298049
Phyra_75184conserved unknown protein
Phyra_75185aldehyde dehydrogenase
Phyra_75186purine nucleoside phosphorylase 1

Sequence
27416 bases(100 bases per row)
TCGTCGTGTTTTTTTAAGGTGCTTTACAAGGGCTTCAAACCCATCGGACTTCTTGACCTTCTCCCCCACCTTCGTCTTCTCGCCAGTTCCATGGATGGCC
TTGTAGTTCTCCGGCACTTCCATTCAGGTAACAATGATCTTGTAGTCGTCGCGGGAAAGGTGAGACTTCTTCATCACTCTCCCCCCTCCGCTTTCTTCAC
CTTCCTCTCCGCCCTCTTCCTCCTCTCCGACCTCCTCAAGCTCGATATGCGCTTGCTCGTCTTCATCTTCGTCGCTTTCAGCTTCCTCCTCTCGAAGGTC
GAGGATTGGCGTTGGGGAGGCAGCAAGGAGAACCATGTGATCTTCGTCCAGGAAGTTTCGGAAGTGAGGGCGGGAACGAGGGAACCAGCGGGAGCGATGG
GAGCCACAGGTTGAACTTCAAAATGAGCCCTCGCTTATCTCTGAAATAAGCGAAAACATAGGAGGAAATAAGCGAAGGGAAGCTCCAAAGATGAGCCGAT
TTTCTGACATGTTCGACTCCCCCTAATAACGCTGGATTTCAAAATATCCAAGGGAATATCACTATGCGGTGTTACAGGTTTATGTATCGTACAGCATTTT
TGAATATATAGTTTGACAGGGTGGTGTACTTTCACTCCATTTTACAGATCTGGAGTGTTTGGCGAACGGCACAGCAGGAGCCACCATGAAGCTCGTGAGG
TACGTGTGTGCCGCCAACGCGGGACCCGGGGGAGGCCAGCGCCGCTACCCTTCCGTGCAGTGTGCTCTCATGACCCTCCTCTGACTCAGTTGCTTCTCTG
TGTGCCATTCTCTTGCGCAGGTTTTTGATGAAGCTGTCGAATGAGACGGTCACCATCGAGCTCAAGAACGGAACGATCGTGCATGGCACAATCACTGGTG
CGGTTGCTTTCCTATGTTACTTTGCAGTTGAAAGGCTGACTGTAATTTGGGCGCCTCTGTGTAGGGGTGGACATCAGCATGAACACACACCTGAAGGCGG
TCAAGATGACGGTGAAGGGCAAGAACCCTGTGACTCTGGACTCGCTGAGCATCCGTGGCAACAACATCCGCTACTATATATTGCCGGACTCGCTGAATCT
GGACACGCTGCTGATCGATGACACCCCTCGGGAGAAGGTGAAGGCTGGCGCCCCAGCGGGGAGTGGCCGTGGCCGTGGCCGGGGACGCGGCCGGGGACGC
GGTCGTCCGTAATAGATGCGTGCAGATGAGTCTTGCCCTGTGGAGAAGAAGAAGAGGCGAGGGCGTGAAGAATAGCGCAGCAGAAGCACCGCGATGGTGG
CGAGATCGTTGCCGTTCAAGGAGGCGACAGAGAGAACTCGTCGGAGCTAGAATCCACTCGCAAAGGTGCAGCATAGGCATCTTTCTTTTTCTAAGTTAAA
GGGACGTCGTTCGAGTGCTGCGATGAGAGTGGTGGGAGATACATTCATGAGACCATGAGAGGAGGCTACAACAACATAACTGTAGGTGATGGCAACGACG
ATGGCATCGACACAATGGTTGGTGTTCGTGGCCTGCAGCAATTCTTCCTCGTTTGTCGCTCTTTAGGTACGTCGGCCTCCAGGGCATCAAGCACACAAGC
CCTATGCGTTGCATGCAAACGAACATCATGCCGGTGCCTGCCAACCAGTGCAACAACAAACTTCGTCGTACTTAAATGAATTCACCAGCTTCACTATCAG
TAGCAGGTATTACAACCGCAGCCGAGATGCCGCAGCAGAACAAGCGCAAGGCTGAGGAGGACGCGGCCGACGCCGACGCCAGCAGTTTCCTGGAGGGCGC
ACAGCGCTCCGTGGACTTCCTCTTTTCGTCGGTCGTCGTACTGCCGGGCGACGATGTCACTGCCACGCTCACCAAGACCACGCGTCGCGTCAAACTCGGT
GCGTGACTTCTACTTCTGCTGAATAGTATACCGAGTGCATAAGAGAAGAAAGCGTAGTATCAGAAGATCCTGACCAACTACTTGCACGTGTGCTAGGTGC
TGGACTAAAGCAGCTGCCGGACGAGAGAATTGTGTGCACGAACGCCGGTGTCCTCCGCTATCGCCCAGCCAACCGCTACTGGGTCGAGTTCAACCACAAG
CGCGTACGTGAAATACTGTGCCAGCTGCCATGCTAGCTGGTTTGCCGGTTTGCCGGTTTGTTTAGACGACTTATTTGCGTTTATTTGCTGCTTGTGGTTT
TTGGTGTGCAGTATGTTGCGTCCATGGACGACGGCGTCATTGGCATCGTGACGGACCGCAACGCTGAGTTCTATCGAGTGAACATTGGGGCTGCGTACGT
GACTGTTGCCCTCTTCTCTGTCGTTTGTATCTCGTTGACTCTCTCTCTCTCTCTGTTTACTCAGTGCTAGCGCTATGTTGGGCTCGCTGGCGTTCGATGG
CGCGACCAAGCGCAACCGCCCTAGTCTTGGTCTCGGATCTCTCGTATATGCTCGAGTGAGCAAGACCAACTCAGACGTAGAGCCTGAAATTACTTGTGAA
GGTGCGGTCTTTAGGCGTTCCGTTGCCTACCGTGCTACAGCAAGCTAACGTTGGTGCTCGCTTTTACTTTTCAGCTCCCCCAAGTGTGACCAAGAAGGAC
TGGATGACTGGCCTGGCGATCTATGGTGAACTGAGCGATGGCTATGTGTTCAAGACGTCCATCGGTCTGGCCAAGTCGCTGCTGCACGAAGACTGCCAGG
TGCTACGATCGTTGGGCAAGAAACTCGCCTTCGAGGTGGCTGTCGGCGTCAATGGCGTCGTGTGGGTGAACGCTAAGACCACCAAGAACATCACGATTAT
TTCGAACGCCATCATGAATTCCGAGACGATGTCTCCTAGCGAAGTCGACGCCATGGTGTCTCGGCTTGTGGAAGACGCGGATGACGCTTAATAGAGATGA
ATACATGGCCACCCCCAACTGCGTGTTTTGTCGCCACAAATTGCTGCTGAGTCTGAACAACAAATTTAGCGCTGGAACTCGCTGGCATCCGTTTATATTT
GCTGTCCTCAGGCGCCCAAGCGTCTGCAAGTCGTGCGCAGAATCAAACTTGAGAGCTGAACACGGGTCCGTCAAGAGTCTCGGAGAAGCAAACATGATGT
CTGCGAACGATGACGCCAAGGGCATGATCGCCCAAGAGGAGCGCGAGCTACGACGGGTGTTCGAGCACCTGGGCTCATACCGCCAGAAGAAGCGACTTGC
TCTTACGGTAAACGAATGCAAGGAGCGTCGGCAGCGCTTGGAGTCCAGTCGGAACAACCACGAGGTGTCGGCGCTGCTGAACGAGAAAGGCGCTAAGATG
ACCCGAGAGGAGATCGAAGACGAGCTGCGCAAAGTTGACCAGACTCTAGACAAGGCCGTCAGTGACCAAGCCGCGCTGCAGAACAGCGGCAACCACAGCC
GCGTGATCAAGAACGAGGACCTGTACGAGGCCATCAAGGCGCTGGGCAAGGTGTGCTCGAAGAAGGAGATCAGCGACATGATCTGGGAGGCCGACGAGAA
CCTGGACGGCGTCGTGGACTGGGAAGAGCTGCGCGCCATGTTCAACCGCAATCTGCTGGACAGGACGGAGCTGGAGCCGGCCAACCTCTTCAACGTCGTC
CAGTTCATGACGTACGACAAGAAGAACTGCGGAGTCATCACCGCGGACGACACCATGGCCATCCTCTTCGCGCGCTACGGCCAGTCGCAGCTCGAGATGC
GCATGAAGCAGCTCTTTGGCGACAGCGACGAGCTCACCTTCGTGGACTACCTCGAGCGCGTCGGCAAGCAGCGGCGTTCGAACGTCGAAGCTCGCGCCAA
GGCGTAGACAGTCGCATAAATACAAGCATTAGGTGAGCTCAAGTTGAAGCTGGCATGTACTTCTTCTTGTGTTTGGCATGTGAGGGCTATTATACCAGGC
GTGCAGGCGGCAGATGGGTCTGTTTTCGCGATAAGACGCGATAAGACCCGGTCCGCTGGAAAACTCGAGTCAATTCAAAGTGGCCGTCCAGCATGCACGT
CTTTCCCGGTGGTTCAAGTCGCCGTTGCATGTCGTATGATTTCAGTGAAGTGATCGGAGTCAAGTGTTCACGAAAAGCTGCAACGAATAAAGTACTCCAC
AAGAAACGTGCTCTCTTTTTTGCTTATGTCTCTCTTCTCACGCCTCTCCTCCCGAGTCTCCGCGCCGGAGACAGCTTTAAAAGCATCTCTCTGCTAGATA
ATGGCTGGGTTGGCTGGCGGGGTAAACACATAGGCACCTTAACCGAGCGTGAGGCCCAGGCCGAACTTGTGCGAGTCACCCTCGAAGTTCTTGGCGTCCA
CGTGCACGCTGGTGGTCAGCGCCACGTAAGGGCGCACCTTCTGGATGGAGGCCAGCGACAGGAAGCCCTCCGAGTCGATCTTACCGCAGTACGTGGTGTC
GGCGTCGGCCTTGTACCGGCCACCCACGACCAGCGTGTTGGAGGCCGACTTGAGGTCGTAGTCCAGCACGGCGGCGTACACCGTGTTGTGGGACAGGTGG
TGGTGGAACGAGGCCTGCAGAGCCGCGAAGTTCTTCTTGGTCACGAGCGCCGTGACGAAGTCTCCGCCAGTGTAGCTGGCGCCCACGTTGTGCTGCACGA
TGGCCGACTTGTCCACGTTGAAGGCAGTCTGGCCGCCGACAGCGAAGCCGCCCTGCGAGAGCACGGCGGCGGCCGAGACCGTGTTGGACACGAAGTCGGC
CTCCGAGTTCACCGACAGGTTCTTCTGCTTGTACTCGGCGCCGAGCACGCCCACCTGCTTGGCGCTCGTGTTCTTGGCAACGGAACCGTCCTCGAGCTTG
AACGTGAGCTTAAGACCCTCAGTCAGCACGTTGGGCAACTCAGCCTCCGTGACGAGGCGGCCCTGGGTCGTGATCTGCAGCTTCTTGAAGACTACGCCGC
TGGCGCCGTGCGTGAATCCGCCCGAGACCTTGGCCAGGATCGACTTGTTGGCGCTCAGCGCGCCCTCGGTCGTGAACGAGACGCCGTTGGACGCCTTGCT
CTTGATCTTGAGCTTGCGCGAGAAGTCGTAGTCGTCGCGCAGGACGTTCTCCGCCGTCTTTGCCAGGTCCTTGTACAGCACCACCATCGTCGCTACTTGC
TTCTTCTGCGCGCTAGCTCCTCTTCCGAAATGAAATGCGAGCCGCACAAAACAGCACACTTCGCCAAAGTACTATCGGCTGGCTCCACACAAAATCTCCC
CCTCCCTTCGACAACTGATGTACATATTACTTCTCGCAGGTGAAAGCGTATCTTTGGGGTCGCACCTAAGAGGATTCCGACGGTTCAGCCGACTGTCACT
CTCTCAGATCCCCCGGCAGCAATGACAGTGCAAGTCGTGCTGGCACCGCACTGCCGGCGGCGTGGACTGCCGCGAGCAATGACGTCGTTGGGCAGCGCAG
AAACAGCCGGCGGCTGTCTTCAATGCGCTGCGTGGCGTGTTTTGGGTTGCTGGATGATGCAGCGGGTCGTTTGACAAGCCGCGAGCTCGCACCGGCATCG
GAGGAGACCTTGCCACTAAACGTGCAATAAGGCCGCACCACCGACGTTTCTGCCGGTGCGATTGGAGTCTCGCTTCTGCAAGCTTCAGACAGCGGCAAAC
TGGCGGACGCCGCGAGAATCTCTCTCTCTCTCTACAGGCAGGGCAAGAGCAGGCCGCATTGCATCACTTGCAATGCTTGCACTTGCTGTGATCCGGGGCG
ATTTGACTTGCCACAGTACCGGTATCCCCAGCTTGACTCTCGCTTATGTCCGATGAATCGTACTTAAGGCGGCCGGCGACGTGGCTCGAGATTCAACCGC
CCCCCTTCCTGCGGCTGTACTGGTCATTCGCGAAAAAGATCAGCCAGTGGTAGCCTCAGCTCTCTTCCTCCTGACACAAGTAAGATGGTCGTGCTGTACA
AGGACATCGCCAAGACGGCGGAGAACGTCCTGCGCGACGACTACGACTTCTCGCGCAAGCTCAAGATCAAGACCAAGGCGTCCAACGGCGTCTCGTTCAC
CACCGAGGGCGACATGGCCAGCAACAAGGCCATCCTCGCCAAGCTCTCGGGCTCCTTCACGCACGAGAGCAGCGGCGTCGTGTTCAAGAAGCTGCAGGTG
ACCACGCACGGCCGCCTGATCTCTGAGGCTGAGCTGCCCAACGTCTTCACCAAGGGCCTCAAGCTCACGGCCAAGGTCGAGGACGGCTCGCTCGCCAAGA
ACGCCCACGCTAAGCGCGTCGGCGTCTTCGGCTGGGAGTTCCAGCAGTCCAATTACTCAGTGAATGGATCGCTTGACCTCGGCGCCAGCACCGTGCACAA
GGCTGCCGTGTACAGCTTCGACAACGTGCTGGTGGGCGCTCAGGCCGCCTTCAACTACAACAAGTCGGCGGTCGTGGACCACAACGTTGCCCTGAGCTAC
CGCGGCAACGACTTCACGGCCAGTCTGCAGACCAAGAAGAAGTTCAACGCGCTCTCGGGCTCGTTCCACCACCACCTGTCCCACGACACGGTCTACTCAG
CGCTCTTCAACTACGACCTCAAGTCGGGCCAGAACACGCTCAGCGTCGGCGGCCGCTACAACGCTGACAAGCTCACCACGTACGCAGGCAAGGTCGAGTC
GGACGGCCACGTGTCCCTGGCGCTCGTGCAGAAGATCCGCCCGTTCCTGGCGCTGACCACGAGCGCCCACGTCGACGTCAAGAACTTCGACGGCGACGCC
CACAAGTTCGGCATCGGCCTTACCCTGGGCTAAACAGGGTCATTCGAGTCGTAGTAGACGTGTGTGTGGCTAGCGCTGGACGGCCCGCAGACCGTCCGAC
GCCGTAGCTAAATGTATCGAGGCCAATTCAATACACACATCTCTTGCAGTAGATTCACCACCATGTTTGCTCGCCTCTATTTTACCGTTGTTCTGTGCCA
CACCAAGTCTACGTGGATTTCAGGATACGGCACATAAAGCAAAACGAGCCAAAGCGACGCGAGACAAGCATGAGCGAGACGGACCGCTTCGACAGCATGC
TGCTGACTATCGCTCAGTCACAGCGCGGCATCGAGCCGCTGCTGGATACGGTGTTCTCCTTCCTGCGGCGCAAGACCGACTTCTTCTCGGGTGCCGAGCC
GCAGGTGGTCGAGAGCACGATCCTCAAGAGCGTGCGCAAGCAGGCGGCGCTGGCCGAGAAGGACCAGTTCCGCAAGAAGCAGCAGGAGGATGAGAAGCGC
AGGAAGCAGGAGGCAGCGCACAAGGCGGCAGAACTGGAGAAGAAGCAGAAGCAGAAGCAGGAGGACAAGAATCCGCCGCGCTTCGAGGAGATCACGGACG
ACGAGGTGGAGGCTAAAGAGACCTCATCCGAACAGACGTCGCCTCAGAAGTCGGAGACGACGGCGAAGAAGGACGAAGAGGAGGACGGGGACAATGGACC
GCGTACGCCAATATGTGGATTGGAGTAAGATAGTATCCAGGTCAGCTAACCGTGTGATGCTCTTGTGTGACTGCAGCACTGGTTGGCAATGGAGGCCAGA
CGGACAAGTACGTGTGGACCCAGACACTGCAGGAAGCTCAGGTTAACTTTGCTGTGCCCACTGGCACCAAGTCCCGACAGGTCGACGTGGACATTCGGGC
CGGAAAGCTTAGGGTGGGTCTGCGTGGTGGAGAGACGTTTGTGGATGGACCTCTGTACAACAAGGTGAAGGTGGACGACAGCTTCTGGACGCTGGAAGAT
GGTAACCGCATCTGCATTTACCTACAGAAGGACAACCAGATGGAGTGGTGGAAAACCATTATCCAGGGTGATGCGGAGATCGACACTCAGAAGGTGCAGC
CCGAGAACTCGAAACTTGATGACCTGGACTCCGACACGCGCCAGACTGTCGAGAAGATGATGTTCGACCAGCGTCAGAAGGCGATGGGGCTTCCCTCGAG
TGACGATATGCAAAAGCAGGATATTTTGCAAAAGTTCATGGCGCAGCACCCCGAGATGGACTTTAGCAAGGCCAAAGTCAATTGAGCAGCGGATGGGTCT
CTCATTTTGCAAGGCCAACTGCACTCATGGCTTTGATATTCTGCATTCCAGTGGTAATAGTGATCGCTATTTCGGTGGCCCGGCTAATAATACTGCTTTG
ATGCCCGAACAGATCTCGAAGCTGTCTGCTATTTCTTGTTTCTGAAGGAGATGGCTGCGTCAACGCATCGAAGCTTGTCACTTACCTTTTGCGCGCAAAC
AGATACGTGAGCAGCAATTAGAAATGGCTGGAGGTCGTCACCAGGTCGTGTCTGTGGTGCTGGGATCCGATAAAATCGAGTACCAGAGCAGCAGTGCCGC
CATGAATCAGCACGTCGGTGAAAAACCTCCTGGCACATCAAGAAGGGCCGACGAAAATATTAACAAGGAATGCCACGTGCAGTGGGGCGAGCCCGGCAGC
AAGCGAGAGTTCACAACCTCCAGCAAACTTGCAGACCCAACAGGAGAAGTACTCAAGTACCGAGGCGAGCTAGCTGCAGAGGCCATGGACATGCTCACTC
GCACGTCTTCGTGCTACGGCAATGACGTTGTGCCTTACGTCTCGTCGACACAGCTAGCTACGCAATGGGACAAGAAGGCTGTGGCGGAGACCATTCGGCT
ACGAAACGAGATTCGCGCTCGAACAGGCCCACGACCGACCCGAGGCATGTCGTACGACGAGGAGGTGGAGTATGTTTCGGAAGCCAAGAGCGCCTTCGAA
AACAAGTTCAAGATCCACAAGCCTTCGATCATGGCTGCGTCTGTGAAGAATGGTACAGTAACAACTGCAAAATTCATGTTCGTCGATTCCTCAGTCACTA
ATGTGCTGTTATTTTTGTGCAGACCTGCGCTCAACGCACTATTCATTAGGACACGAGAAGCTGGACTACAAAACATCAAGCCACATCGATCGTCTCTCCC
CGGATCAGTTTGCCATTTACGCAACGCGGCCTCCACCTCTCCACGACCTGAAGAAGTCTACTGTGGATATCTCTTGAAACCAGCAGATATGATAAGGACG
CCGTTAAGGATGTTAGCTTCTAAGACAACCAATACATCGCTTGAAATGATGATATTATTATTGGTTGGAGCTTTGTAGCACCGGACACATGTGTTACGTC
TGCGCAAGGGCAATCGTATACAAAAGTATCTCCTCTCCTTCTCGTTGAGCAAGCAAGCTGATGAGAGCGCTTGCTGGCTAGACGTTGAAGCTCTCGCCAC
ATCCACAGCTGCCCTTGGCGTTTGGGTTCTCAAACACGAACTCGGATGAGACCGGAGTTATCTGCACCACCAACACAACAACAAAAATATATTCAGTCTC
CATCTTTCAACTTGCGAGTACGCAATGGGTCCAACCTGGAAGTCCATGGTCGTGCCGACCACATGGAATAGTGCTTTGGGCTCAACGAAGACACGAATTC
CTAGCAATAATGACAACAACCAAGCACGAACTGTCAGTATCTAGTTCCCAGTCAGGCAGCAGCTACCTTTCTCCTCCTCACCGTTCTTGCTCACTTCCTC
CTCCATCTTCTCCTTCTTGTCTGCGTAGTTCATCGTGTATGACAAGCCATTGCACCCGCCTATCAGTTGCACCAAAAACAGACCGTCAGTTTGTATCGTG
GTCTGCACCACCAGGACGCATCAAATTCGCTATCACGTACGCGTTTTAACCCCCAGGCGGATCCCGATAGCGTCCGGTTTGTTCGCCAGCAGCTCCTTTA
TACGCGCCGCTGCAGCGTCGGTCTGTACCACATGAGTCAAAGAGCACACGCCATTAAGTCAGGACCTCACACAGTTTCCACATAAAAAACACCCTCGACG
CACCAGGTTCAGCGGCGGCGGCAGCTCGCGCAGACGTCGACGGGTAGGCGGCGTCGCGTGCTCAGCCACGGTGGATAGCAGGCGTGGCACGTGGGCGACC
CTGGAGCGCGACACGGAGCGGAAGAACGGCGTCATGGCGTGCGTTCCGACAGCTATAAGCTAAGCAACGTTGAGAGCCGCTCGAAACGCAACACAAAGTG
TCGCATCCAATACCGGCGAGAATTGGATAACAGTACCGTACCGAATCATTTAGGTGCGGGTTTGGATTAATTTGATTGGTCATCGCCTGCTATTTCAGCC
AATAGATAGCGGTGCCCATCTCCCCGTCATTTAACACTTCAAGCCAACGACAATTTGCATCGCCACCGCCGGACAACGCTGCTTAACTCGCTTGTATTAT
GTGTCGTTGACGGCTTCAAAGCTGCTGTGCCGTCACCCGAAGAGCTCATCGCGCAGCGCCACGAGCTCGTCCCTGTGTTGGCGGATGAGTGCGCGCAGCA
CATCGCCGCCCAGCTGGAAGTTGTGGATCAAGTCCACCCTCTCCTTCACCGTGCGCGCCCACTGCTCCTTCGCCGGAGATGTGTCACCTTCGCTTGGAGG
TGTCCACTCGAAGATGTTGATGCGCGGATCGAACTTGGACGCTGGCGCCGCCTCCGTCTCCGCGGCCGCAGCAGTGGTGAGCCCGCCATCTGGTTGTCTT
GCCGTCGAGGATGTTTGCAAGGCCTTTCCAGTCGCTGAGGGCTCGTTTTCAGGTCCAACAGACACTGTTTCGATCGCCGTCGGATCAATAGGATCGGTTG
TTGGTGAACCGTTTGCGTCCTCTGCATGCGGATCCTTGGATGCAGGCTCAGGATCTGTGAGGTCCGGATTAAGTGCCGGTAAAACGTCAGCGATCTCGTC
ATGTGGAGCCTCGGTTGCAGGACCGGGTTCTGAAGTTGCTGCTACTGTTTCTGGGAACGGCTTGTTCCCCCACCACTTGTCGTAGAGGTATTTTTCTACG
GCTTCCACTTGTGCATTATCCAGAACGGCGTCATACACCAACACCTCAGCAATTCTGCCCTGGAATGCATTGGTATCGCAAGCGCTTTTGCTGTTGCCCA
AGCTCACCACCTCATTCACGGTGATCCGGACATGTCTCTCGTCAGTATCACCTTCCACTGGGGATTCGCCACCCCAAGGTCCGCCGTTCACTTTGATTTC
GGCGTAACCCGAGTGCAATCGGTATGTGAGCAGCGAGAATCGCCCTACGGGCAGTACGTGGTCGCTTTCGACAAGCCCGTTGTTGGCGTAAAAGGATGGC
TTGCCACCATGGAGAGCGAATTGTCCGTACGGCGAGTTCCCAAAGAACTTCTGCCCGGTGTACAAGTCGCCCTGCTGATTAAAACGATATTCAAGGTCAG
CGTCAAACTATAGTTTTCGTCAAGTGAGCGATCGCTTACCTCCACTATTTGAGCCGGAGAGATCACGAAAAGCAATGTCATCGACTCGTGCACTCTACCT
GTTTCAGTGACCATGGGGCACGAGAAATACACTGCAGGAAGTTGACTGTGAGTGTCCGGCGCGATCGGTACCCACACAGTACTTTGCTGTGGTGAGGCTG
CGTGGAAGGCAATTGCGTCTGCAGCATAATTGTCCGAGTTCACAATTTGGCTAGTCCAACTGCATGAATTGAACAAGATCAGTAAGTGATACCGGGTGAC
ACGTTTGGATCGGGCTATGAGCCGTACCTGATCACACCACATGCAGTGACGTCGTCACCAGAGGACGCTAAGCAAGCTGCCAGGTTCTCCACTTCGACGC
CTGAGTCAGCAGCGAGCCACATCGACAAATTATCTAGAAGAGCTGAGGAACACCACAGACATACAAACACAGTCAACTTGGTATCCCTGTAGTAAAGTTT
TTACCGCCAAAGTGGGGATACCGTTAGACGCAGGTTGAACCTCCAGCAAAGCCTCCACTGCTTGTACCGTTGCTGTTGACGCGGTGGAACTAAGTTCGGC
CTCGACCGATTGTTGTGGTGACGGCGGCGGCGACAATAATGTGTCTGAGGAGGGTGGCTGGGACTCCTCAATCTGCGAGGGTTGCTCCGTGACATCGGCT
GGAGATCGCTGTGACCCAGTGGAGGCTAGCACTGACGAAATATCTGCTTTGGTGAATGCTTCGCTTGTGTCTTGATTAATGTCGGAAGCAGCAAAATATA
GCGTCTGTGACGGCACAGATGGAGCGCCAGATGCAGGGGAATGAGCTTCCTGGGTTTCCGACACCACTACTGGCTCGGGATTCAATATCTTCTCTTCGTC
ACCGATCTGTTCTGCAGGAGTCTCATCGCTGGGCACCTCAGTTATCTCCGTCTCGCTTTCTGTGCCATCCGTCAAATCGAGATCTTCCTCTGGTGTTTCG
GGATGATCAGTGCTCGTCAACATTGTGTAGCCTCCGGAACGGGCGTTTTCCTGTGTTTTCGGCGCTTTGGTCATTGTTAAGTCGGACGCTGACAGGGTGG
AAACTTGGTCTACATTCTTGTTCACCGGCCCCGGGTGCTGGTGATCTTGCTCTAGTGCTTCATTTACGACACCTTCCCCCGATAGAGATGGGAAACGCGA
AGAACTCATGAAGATAAATGCAGTGACAATGACCAAGTTGATGACCAGGATCAACCTGTGCCAGTTGTACAAGTCGTTCAGTCAGTCGACATCATTGCAA
GTGGACACCAGCGATCACGAGCACAGCACGCACCATATCCTGCCGCGGGATGTCGTGAATGACACTCCTCTGGAGGCTTGTCTTAGCTGGAATGCGTTAG
TCTGGCGGTTCGTCAGGCGAAGGTCTTCATTATCATTGCCATTATCATCATCGTCGCTCATTGGGGCAACGTGTCCCTTCTTGCTTCGGCCATGCTTCGA
TAAGCGCATGCTTTGAGTTGTTGTCTGCACTATAGCTCTCGGCACAGCGACACCTTCGCTTGGCTTCGATTGCTCAACTGCAGATCGCGACTAATCGGGC
GCGTGACGCTTCAGGCCTGTTGAACGGCGCTGTAACATCTACTACTGCAGCAAGAAGGTATCCGAGAGGGTCTTCGTATCTGTCGATAGTATTTGCGTAC
CATCGCAGAGTCGATCAAACAGACCACGCAAGGCTTCGCTGCATCTCAAATTTGGCTTTGTCATCCAGTAGCAAGTTGCTGCAGCCGCCACATCACCAAC
AACAAACAAAATACAGCAACCCCTTCAACGCCGCGGCCTAGAGTGGAGCAAAAAGGTGCGTGTCCGCATGTGTTGTGTCTCCTTGTTCCTATCCCTGCTC
CTGGCTCTGCTTCTGCTCTACATCTAGTACGGGTCCGTTTCGTTGAGCCACTTTTCCAGGCCCTTGAGGGGTTTGGCTTGCTTGACCGCCTTCTTGTGTT
CCGCGATCTTGCTGGGCATAGCCGCCATAGCCGCCTGCACCTTCTTGACGCTGTAGCAAGCAACAAGCAACACACACACACACCTATCAGTCTCTACCCC
AAGGCGCCACTCACTCAATCGCCCCATAACCTACCGATCGAACTCGTTGCGTTGGTTCTTATGGCCCTTGAGTGGCCGCATCACGTGGTGCTTCTGCGGT
CTGTCCCACGTCTCAAGCCAGCCGCCCTTGCCTTCCTCCCACGTGCCCACGAGACCGTTGCGCAGCGCGTGCTTCTTCACCATGGCGACCTTGCGGCCCG
AGATCAGCGGCTGCTTCCACTTGCCTTCCACCAGCTTGGGCTTCATGGCGGCCTCGGCCTCGGTCGCGCTCAGTCGGAGGAAGCGCTGCATACCGCTCAT
ACTCGCTCGATATCGGCTATTGCTCGAAAACCAGCGGTTTGCGTGCGTCCACTTTTTAGCCAGTCATAGCGCACTATTTGATTATCAACAAATCCCGCGA
TCGTACTTAATCTAAATATCACAGTACTGACCCTAGCGTGAAAACCTGGAAAAGCACATAACGTTAGCGATGGACATGGCGACGGCGGCGGCTCCGCAGA
TGGCCGTGAACCGCGCGTTCGCGGCACCGCAGCAGACGCAGGAGCCCAAGCAGGTCACGACGGAGCAGATCCAGGTGCGTCATCTCGCCTACGCGCAGTC
TCTATCGGTCTCTGACCGGAGATTTGCCTCTTGTCCCCGCAGGCCATGCTGGACGAGAACTCGAGCCTCATCGTGGAGATCATCGAGCTCAACACGCAGA
TCAAACACGGCAAGGGAACGGCGCAGCTGGGGGAGTTCACGGAGAAGCTCGACAAGAAGCGCAAGAACCTCAACAAAAACCTCATGACGCTGGCCAAGTG
GGCCGACGAGTCCTCCGACACGTCCCCCAGACAGCCGCAGGCCTACGGGCAGCCTCAGATCCCTCAGCAGCAGTACGCCCGCTCAGGTATGATGCAGATG
CCCATGGCCAACCAGGCTCAGCTCCAGGCACAAGCTCAGGCTCAGGCGCAAGCGAGAGCGCAAGCTCAAGCTCGGCTCCAGGCGCAGGCGCAGGCTCAAG
CTCAGGCCCAAGCCTATGCTCAAGCCCAGGCTCAGTATCAGGCACGCATGAACCCAATGATGGCCCAGCAGTATGGACAAATGAACCCCATGGCCCAACA
GCAACAGCAGCGATATGCCAACGGCGGCATGCCCTACGGCGTCCCCGGCAGTGGACCGATGTCTCACCCGGCCCGCATGAGCAACGCCATGCAGGTCCCA
ACAAGCTACGCAGATAACCGAGGTGGCATGGTTCCCAACATGGGTTTTCAGATGGGCCCCCAAGGGTATGGAATGATTCCCCCCACGCAAATGCAGCGCA
TGAATCCGGCGACACAAGGAATGCCCCAACAGGGCATGCAACAGCAAAGTATGCCTCACCAAAGTATGGCGATGCCTCAGCAGAGCATGGCAATGCCTCA
GCAAAGTATGGCAATGCCCCAGCAGAGTATGGCGATGCCGCAACAAAGCATGTCCATGGGCCAACAAGGCATGTCCCAGCAGAACATGCAGATGCCCCAG
CAAGGAATGGCTCCGATGCAGATGAATGGGCCTCCGAACTCAGTCCCCATGGCTGATGCATCGGGCCAACCGAGTAACTAGTTGCGAGAGAGAGCTACAG
CAGTAGGTAACACGTCGCCCAATTCATTTTCAGTATCGCATGGTCTACTTTAGGTGCAGGCTACAACTAGAGAATTTCACTAAGTCAGCGCACTGATAGA
TGACTACATCCAATGCTACATCGGGTTGTACGACTCCATGACGAGGTTCTCGTGCTTCGCTTCATGACTTTGCCGCAGTCAGCTTTCGTCCAGCGCAGAT
CAGGTCTTGAAGTGCGATCTCAACACACGTCGCACGTAAAGTAAGCGGTACGAGTCCTCTGAAGTGGTATAACATGTAACCGTAAAGTAACAATAGCTTT
TTAAAGCAATTTGGCGGGAAGCACATTTTGGCCAGAGCTTGGTCGTCGCTCTGTGCGCATGGCGTCCCAAGGCATGTCTTCGTGGCTGAGCGTCCCCAAG
TCGGAGGTCTCGGACACGCTCGATACGTCGGAATCCCAGCCGCAGGACAAGAGCGAGGACCGCAGCGACTCGCCACTGGACATCAGCCTCGCACAGTTGC
GTGCCAAGGAGACCATCACGCGCATTAGCCCCGACAAGCGCTCGCTCGTGGAGGAGATCGACAGCGAGGCGGACGATGCCGAGTTCGACGAGAGAGCGCA
CTGGGCCAGAAGAGGCGCTAGGAAGAAGGCCAGAGCGTCGCGCAGAGCTGCCCGAGCGGTGGATAAGTCGCAGCCGTCGATCGCGCTCTTCTGCGTCAAG
GGAGTGGAGAAACCGGAGGCAGTAGAAGAGGAAAATGCACTTACAAGTGCCATAATGGCCTCGCAATCGGAGAAAATCGCGGCCGAGAAGAAGAGCAAAG
CGAGGAAGAAGAAGGCGAGCGCTGGACTGGAGATGGCCTCGGCAGTTGATAGCAGCTTGAAGCAGGACGATTTGAGTACTGTGATGAGTTCTGGACGACC
GAAAAGGCATGCAGTGATGAAGACGGAGATCCTGCAGCAACAGCAAAAACTGCTGGATGCAGTCGCTGCAAGGAATAATGCAGCTTCTTTTTTGACACCG
CCGCCGTCCACGAAGAAAACCGAAGCGAACGTGACGACTAGTGGGCGCAAGAGGAAATTGGAAATGAACAAGAAGAAGACATCTCCTCCTGCAAAGGCCG
TGTCGACGACTAACTCACCCGGAGGTAACAAAACTGCGCAGTCGTTCTTCTTAAGTGAGCAGGAGAGGAAGCAGCTGCAAGAAATTGAAGCTGTGTCGAC
GTTCCGTGAGCAGCTACGCCAGACTCGTGAGAAAGACCTTGCCTTCTTTGCTGGTCAAACAGCGAGCCCGTTTTTCCAGGCACGAGCCGGTGCTAAACGT
AGCAGCAGTGCTGAAAATGACGATGGCATCGTTGAGATTCACGAAGATGGCGAACCAAAGCCACGTCGAGGTACAGGTACGGGGCGTTGGAGCAGGTCAT
TGTCACTTTTTCCGAATGTGCAGCACGTGCTCTCCATGTGCGTAGAAGCAGAGGATATGGATACCAGTACGAACGGCTCGATGCCGTCAATGAAAGCGGT
GCCAAACGTGGACATCGCCACCGCCGTGGTTGTCATTGATGACGATTCCACAGGAGACAGCAGGCTGCCAAGTGACGTAATGGGCCAACTGAAAGCAGCC
ATGAACGGGCAAGTGGTCACAGAGTCTTCGTTTTCAGAACAGTTTTGGTTTCGTGAGTTTTTAGATGCATCGAGTATCCCAGCACCAGTTGTCGAGGCAA
TCGATGTCACCTCGCCGCGCCCAGTGGTGAATTCAGATGCTACTGCAGTGGAGCTAGCACAAAGGGAGACTCTGCTCATCGACGAACTCGTTGAAACACA
CGGAATGCGCGAGAAACGAGTGCGTGAACTTCTTGAGGGGCTGGAGCAGGCCAAGGCAAAGCGTGTAGACCGCGAGCAAAACTTGTCGTTGGTGGACCGC
TACTTACCGGTGAATGCAAGCGGCCTTGTTGGAAATCGGGATTCGTTGCACACACTATCGTCATGGTTGAGTGCGTGGAAAGTCGGTGGCGGTGACCGCG
AGAGGCTTGATTGTTTTTCTACGGAGCTTTTTACATTTGAAGACGGTGACAGTGATAGCGAGGACGAAGTAGGCGACTTGTGTCGTCTGTTCATCCTGGA
GGGTGAGTCCGGTTCTGGTAAATCTGCTGCCGTCTATGCATGCGCAGAAGAGTTGGGATACGAAATCATTGAAATTAACGCGGCTCAAAGCCGCTCTGGA
AAGAGCGTCGTGGAGCTTGCGGGTGAAGCTACGCAGTCCACCCGAGTATTGCACGTAGGTGGAAAGGACGACAAGAGCAGGAAGAAGCAGAAGCAGAAGA
AGAAACGGCGGAGGCACTCTGAAGGCCGCAAGAGTTTAGAGAAATCCACAGCGGCTTCGTTGTCGCTTGTGCTGTTCGAAGACGTGGACCTGGTCTTTGA
CGAAGACAAAGGTTTCCTCAACGCCGTGTGCTCAATCGCAAAACATTCAAAGTGCCCGATTGTCGTAACATGTGCGCAGCTACCTGATGCATTTCCCACG
AAACCTGGACGCCTACGTCGTGAGCTTCGCAGACCTTCAATGGACGAGTTTGCAACTTGGCTGCATCTGGTGGCTTTCATCGAAGGGCTTCAACTGGTAC
CGTCTCTCATTGATGCACTGGGCAAGTACTTCGAGTGTGATGTGCGGCGCTCCCTGAATTTTCTGGAGGCAAACTTGTCGCCGTCTGAAGTAAATACCAA
GGCTCAGTGGCGCTGGCAGCACGTAAGTGCAGACAAGCGTGATGCTGATGAGTCTGGACACGTTGATATCCCTGCGTGGACTGTCTGGTCAACTGGATGC
TCCTCATTTGACGCGTTGACGAGCAACTTACTTGCCGAGCTCAGCGCTGTAGAGCAGAACATTGAGGACAAAACCCGCGAGGAAAAGCAGGCAGATATTG
ACGCTATGGCGGATCTAGCGCAGATCTTGGATGCTGCTTCGGTTGCAGAGACTTGGATGGCGCCAGCAACGGCTTCTTCCAGTGGCAGGCTTGCTCACGG
AGATGCCGAGGTACGATCAGCTTTGTTAGTTGCTCGCTCGCTATAGTTCACTGAGGTGGTTGTTCCCAACTGATAGCAGGATTCGTTCTTCCTCTCGGAA
TGCGAGCGGCTTGCAGCCTTAGAGTTGAGACGTTCCAGTCTCCACATGCTAGTCTCATCGACGAACCCTCTCGGTGCGTTGCTGATGCGAGGGCAAGGAC
CTTCTGCCTCGGCTTGTGTGCAGCGGACGTTCGATAGCGCTCTGGCTGCTTCCCGTCGACGCGCCCACCAGACAGCGCTGGCGGAGCTAAAGTCCAAGTT
TGAACTGCCGCCTGCTTACAAAGGGTGCGTTTTAGGCAGTACTCACTGGACTGCAGTTTTACCATCTCACGCTCTTTGTTTCCGATCCAGCTGTGGGAAT
TCAGAGCCGCAATTCGTGCTCGACTACATGCCTATGGTCGGGCGCTTGCTGTCCAGCACCGGCTTGCAAGAGGGTCGGCGACGGACATCCCGGCGCAACC
ACTATTTAGGCGACGTGTTGGGGGACATGACCCTCATCGACGAACTGCCAGCCTTCAACACGTACATCCAGACCGACGAAGACCAAATCATCGCTGCATC
TCCGGCGTCTACGCAGTGACCAGAGATATCTACATCTCGGGTCGATACCAACTGAACCTGTGTACACCCTTGTAGCTTTGTAATCATCAGAACTCTTCCA
TTTGGCTCTCCTTCTCGATCTCAAGGACGTCCATCTATCTATTCCGTGGTCTTCTTGACCTTGGCCACCCGCTTGGGGCCTTTGCCAGCCACATCCTTGA
CGGTCACGTCCACCTTAGTCTTGACGATCTGGCTCAGAGACGCGTGGAACGACGCGTGGCTCACAGACGTCACCTGAGCACAAGAAAGATGTTACAGTTA
GTCCAATGGACCCCCTCAACAAACTGCCAAGCATCCGTACCACCGTGCTGTACTTCTTCTTGTGCTTGTTGTTGCCATACTTGCAGGCGCGGAAGAGCAG
CACGTGCTCTCCGTCCTCCACCGAGAGCTTGCGGATCTGCTGCTGCGCTTTGGTGTTCACTTTAGCCACTGGCACTGCGTCATGAAAGTGTGGACAAGGT
CAGACAATGGGGAGACACTAATGCAGTTGCAGGACGCACCACTCTTGCAGGATACGGCCACCGAGCCCTTGGAGCTCTGCCCCTCCGCGTACAACTCCGC
CACCTTGACCAAGAACGTGTCCGTACTCACCAGCACCATCTTCCCTTGTGTGTGTGAGACTTTGCTGGCAATCAGAAAACCTGCAGAAAGCAGTATCAGC
TAAGAGGAGTATTGGATACGGCGCTATCTTTCAGACACATCTGATGTATTGTCCGAGGGCTTATGGCGCTGCTCCTAGTCTACCATCGCAATATCTACCA
GGTCACCTGGATGAAATCGTACACTGGCAAGAGTCTTGCTGTCGTCAGCGCATCGACGATGACTGCTGTTCACGTAGCCAACCTTCCGCATGAGCACTCT
TGCACAGCAGCACCAAGTTTGTTAGCAGCCGCCTCAAACGGTTACCCATTGGCAACCAATAATGCTCACCTCCCGTCCCTTGTCTCCGATACAACGCAAA
TACTGAGGCGCATGTTGGGCTTCTGGGCGTCCGCGTTCGAGTCTTGCACCAGGTCTGCGAGTTCACGCAGCGTCGCGTCAGGCCTGCACCAAAGCCACAT
CAGGAATTGATCCAAAGCTATTATAGAGCAACAACAACAAAGCCCTCAAGCTTACCATGTGTAAATGTGCAGCTCGTTGGCAATCGGCTTGTCGTCCAGA
GCTTCGAACGCGTCGGCTCTGCATCAACGGGCACAGACACAGCACAGCCCCATTGACATCAGTCGCAGTTCCTTGCATCAATGCATCAGCCTCTGCAGTC
CACGTGCCTGTTGTGCGCGCCCTTGCTGAAGAACACTCGCAGCAGGAAGGGGCAGTGCTTCTCGCGGTCGATCGTCTCGGGCGGCATCGCTGGAATTGAT
GTCCGAAAATGTATCTATAAATCGACTGGTGTGTGAATACATCAACCGATCGTTTAGCATATTCCATACGACGGGATACCGATATTGAGCGGTGGTGGTG
ACAGTCAAACAGCAGCAACAGACAAGATGGCGGCGCGCAACGTGGTTCGATTCCTCAAGTCGGCCAAGATCTCCTTCTCCAGCTTCGACCGGCGGGCGAC
GGGCGCCTGGTGAGTGACAGAAGCGTCGTATCTCTTCGCGTTGTTGTTGGCCGCTGGACTGACTTTTGTCTGTTGCCCAGTGAGTTCTACCGGCAGTTGA
CGGCCGAGAAGGTGGGCTGACCAGTATAGGAGGGAAGGAGAAATACATTCTGATATGATTTCACATTGATTGCAGACGCGCAAGGTGAACCCTAAGGCGG
AGATCGGCTACGAGACGTCGCTGACGGGGTCGCTGCCTATTATCAAGCTGGACTTCAGTACGTTTGCCAATGGCTGCTGCAGTTTGAATGCGGAGCTGGG
ACTAACTGGTGTTTTTGCTGCTCTCTCGTTGCAGTCAACGGCACCAAGCACGTGATGGAGGTGCCCGGCAAGAATGTGCGCGAGATCTTCGATGAGGTGG
ATTACCACTGCTCGCAGATCGAGACGGAGTACGAGAAGCAGGGCAAGTCCATCGAATAGACGGCTATCTGATCGACGCAAGCGAAACGATAGGCAGGTCT
TTGCTGCTCTCGACGTACTCCCAGGCAGCAAATAATACATACAGCGAACAGACGAGTTTGGAGGTGTGCTGTGTTGCGGTGCTCAGGGGCATGACCTGAG
CTTGCAGATATTAGTAGTAGTAATCCTCAGTACTTCAATATTGGCGATACAACCCGTGACCGTGTGTATTGAGCGTTAAATAGCCTTGCTTCGTTACTGT
GGATCAACGCGCGCGATTTCCGCTTGCACTTCCTCGTCGAAGTTAGGCTGCGTAGCGTACAAATTCAGAGTCTTGGCGCGCTCGAGGGAAAACTTCAGCA
AATGCTCTCTGCACGTTCGGCTCGACCCTGAGCAAGAGCACAACCATCAGTACATAGCAACACGATTGAACCTCCTTCGGTTGAGCTGCTCGTACCGCAT
ACGCGAGCCACGCGGATGCTGACGTCTTGGTTGTGTACGTCCGTCACGAACACCAGCGACGTCTCGACCATCTTGCACATCTCGCGTGCGCACCGAATGA
CTGCCAGCCTGGTTTGGGTGTTATAATATAGCACTGCGCAGCATCATCGACGCACATATCCAGTCAGCGCTCTCATAATACAGTCGCAGCAAGCCACTCA
TAGCCACGGACCTTGGAAAGCATACTGCGCTAATCCAGCTCCGAAATCCCCATAACTCTTGGTGATGGACTCACGGATCAGCGCCGCGATGTCTTCCTTC
TTCACCGCCAGCTTGCGCCCGCCAGAGGCCTCCACCACGAGGTAGCGAGTCTTGAGACGCACCATCGTACGACTTTTGTATGGCGAGCGCAACTTTGTGT
AACCTCCCAAATTCGATGGAAACGATTAATATCGGCATAAGAAGGTTCAGGACGAGTTGAAATCGATTCGACATGAGCAGCGCAGCAGGAGACGTCGCAG
TGCCCGGTCAGCGCCTGGCCACGGCGGACGGAAAGCTCAAGCCAGGAAGCGGGGCGTATGTGCACAACGGAGCCATCTTCGCGTCCATCTGCGGCACGTG
GAGCATCTCGCAGGACGTCGTGGAGGTCACGCGCGCAAACAAAACGGTGGCATCCGCGCAGGTGTTGCGACTCAGCGACGTGGTCCTTTGCCGCGTGGTG
AAGATCACGTCTCGGCAGGTGATGGTGGACATCCTGTGTGTGGACGAGACGGTGCTGAAGGAGGCATTCCCCGGAACGATTCGCCTGGAAGACGTGCGCA
ACCACGACGTTGACAAGCTCGTCATGGAGGAGGTCTTCTCGCCGGGAATGCTCGTGAAGGCAGCTGTGCTGTCTTTCGGTGACACACGATCCTACTTCCT
CTCCACGGCGAAGTCAGGTCTGGGCGTTGTGCGTCAGCCTACAGAGCAGGACAGTCAGACGACCGACATGGAAACAGAGTAGAACTATAGGCAAAGCTGC
ATTGGAGAGCCGCAGCTTGCTAGGCAATGAATAAGCGTGCCGGTCTTCGTGGTTGTCTCGATAAGCGATTTGCACGGCAAAAGTAGTAGGTTTGTCGGCT
GTTGCATCGAGTCCCACTGGAACTAATCGTCATCTTCGTCTTCCGAGCTCTCCTCCTCAATGATCTCAAAACGCGTGAAAGGTTTCTCAAACGAACCTCG
ATCAGGCTGCCGGTCGTGTGTGTTCTGGTTATTCTTCTGTTCATTCAGACGCATGTCGTCGTCGTCCTCCTCAATGATCTCAAAACGCTTGAACGGCTTT
TCTTCAACCTTCTCGATGATCTCAAAACGCTTGAAAGTTTTTTCTTCAGCCATGACAGGCGAGTCTTCGTTGTTCAATAGAACACCATTGACCTCTTCGT
GCTTCTCTTTTGCGGCTTTCAACAGCTTTGTTACCTCACGATTCCCAGGCTCCAACCGCAGAGCCTCTTTGAAGTCTTGTACCGACTCAGCGTACTTTCC
CCTCCTGTAGCGAGTCATGCCACGACGACTCCATCCCTTCATATAGCCAGGGTCGAGCAAAATGGCGCGCGCACAATCGTCTTCAGCAGCGGCGAAGTTC
TTCATACGGAGATGCACCAACGCACGATTGGCATAGAGGATAGCGTCTGTGTCGTCGTAGGCCATACTCCGGGTGTAGTGCAGCAGAGCCATCTCCAGTT
CATTGGCCTTGAAACAGTCATTGCCCTTTTGCTTTTCGTATCCCGCGTACACTTTCCGTGTTTCTGGCTGGAGCATATCTAGCTCAACAGACTTGGGAAG
TGACTCCAGCTCTCGCTTTCGCGAGGCGACACGCTTTTCTTGCTCTTCTCGCTGCTTTCGAGCCTGCTCCTTGGCTCGTTCGCTCTCTTCATCGAGCTCT
ACAAGAGCCTTGTCAACATCGTACTTCTCCCACGATCTAAAATCGTAAGCTGGGATCGCCTTGGACTTCTTCTGGTCACATTTATCTGGAGCCATCTTCG
TAGGGGAACGTGCAAGCTCTGACTCTGAATCTCCAGGAGCTTGCTGCCCTCGCACAGGAGGCAGTTCTCGTTTGATCGGAGCTTGTCGCATGAGGGCGTC
ATTCTTCAGGTCCATCTCGGCCGCCCAATGGGACAGCTCGTCAATCTCAGTGGTCAGCTCGTTGGTTGTCGGCCCCGAGCGCATTCGCAGGATCTTGTTG
CGCTCTCGGTCAGGCAGCAGATCCAGGATACGGTTCTCCGTGGTCTTCTCCAGATCAGGATAGCGACCTTCCTTGCCCGATCGGAGCGTTGCCAGGATCC
CCTTGAGCTCGTCCAGGTCGGCGCAGCGCTCCACGAAGCCGTAGTCCAGCATCTCCACGTCAATAGTCTTAGGCTTGCGCGTATGCAGCGCGAACAAATC
TGGCTCGGCCGCGTTGGCAATCGTCATCCTGTCTTGCAGTATCTGCGTCGCGGCGCAAAATCCGAAATGCGGATCTTCCAGAAAAGCGCCGCTTCAATGT
GCAGAGTGATGGTCTTTAGGTTGAAGTTATTCATAGCATTGCGACGTTCGACTCCTGCGCATTAAAAAGCGGGAAACTGCAGGAATATGGAGACGGCGGA
AGCTCAAGCTACCCCCGCAACTGGAAGTAGCAGGGCTACCAGGAGTATGGCACCACCTCCCCCAACCCCCGCAGCATCGACGACGACGTCTCGCTTGGAG
CACGGACGCGCCTCCAGACACGAGGACAGCGGACTACTATCAGACGACGATGTAAGTGATAGTATTGCGCCATTTATAAGGAGAATGAGATTGACTTTGG
CTTCAATTTGTAGTTCTACGACGCCCATGAAGACGTGGATGCGGACGCTTCGAGACAGGCCTCGACCGGTGCGTTCAAGGTTCTACCAGGCTCAACGCGC
TTATACTGATGCTTATATTGCTTGCATTACTTATTGGCAGCCTTGAATACCGCCACCAATCAGGCATTGAGGGGGCCGGAGATCAACAACAAGGTTACCG
ACGCAGACGACAGCAAGTACATTGTGAAGAACAAGGACACAGGCGAGGTATTCGACATCCGGGACCTCGCTAGCTTACCAGCGGACGCGTACTCGATTTT
TCCCAATAACTTTGTTGTTCCACAAGAAGAAGAGGTGCGTCAGTGATAAAACGGAGTACAAAGACGCTCTTGTGGATGTTGCTTAGTCAAAAACTTGGTT
GTGAGCAGGTCAAACGGACCAAGACCAGACGCCCTTCTCTGACGAAAATCATGTCTAGATTTCCGATGAAGTCTAAGGCGAAAGAACCGACGAAAAGGAA
CCATGTCCCGGTACTGCATCTTGCTCTTCTTGTTTCTATTGGACTTGCTGTAGGATAGTTTTTCTGACAACACGTTGCATTTAGGTGACGTCGTGCAAGA
AAGAAAAACGGGACCTTGAAGATTTGTGTTTAGCACAAACGTTATCCAAGCACACGGGCACTATTTGGACGATGAAGTTTAGCCATGACGGCGCCCGCCT
TGTTTCTGGAGGCCAAGATGCTATCTTGCGCGTTTGGAAGGTTCAGATTAGCTCTGAAGAAGACGCAACAGTGTCAAGGGAGAGCGAGGAGAAACAGATT
CTTGATGCAGAACCAGAACGGTCTTACCAGGTGAGTCAGCGGGCATGAACGCTAACTCCATGCCTCGAGGCGAACAAATATGCCTCCATTGACTGCTTGC
TTTCGCTTCGTCAGGGTCATACAATGCCGATCGTCGATGTATCCTGGAGCCGCAGCAACTTTATCCTCTCTGCGTCGATGGACAAGGTTTACTATTATTA
CGATGTCATGTACGAAATGCATCACGAGCTGACAGTGATCTTTTTGTTGTCATCCTAGACGGTTCGGCTGTGGCACATTTCCCGTGAAGATTGCTTGCAT
GTTTTTCACCATCCAGATAGCGTGCCGGCAGTAGACTTTCATCCAAAGGTTTGTTGAATGTCTATCGCCCAATTGCCCAAACTTCGTGTTGACAACGAAC
TCTGTACTTGCAAAACACAGGAGGACAGATACTTCTTATCCGGATGCTTCGACAACAAGGCGCGCGTTTGGGATATTCCGGACGGCTGCGTGGTTTCCTA
CGTTCAAACACCCGTGATGATCACTGCTGCCAGTTTTAACCCGAGCGGTACACGAGCCATTGTTGGTTTGCTGAATGGCCAATGCATCTTCTACCAAGTC
AACTCGCACCAGCAGATGAACTACTACACTCAAATTGAGTGCCGAAACAGCCGCGGGTCGATGAGAAAGGGGCGTAAGGTTACTGGCATCGAGTTCGATC
CAGAGGGAAAGTATTTCTTGGTCAGCACGAACGATTCCCGGATGAGATTATTCTCAGTGGACAATTATTCACGAATATGCAAGTACAAAGGCCTCGTCAA
CGGGCACCTTCAAATCAAGGGACGATTCAGGTACGGCTCTGTGATGTATGCGAATTTGGGTGGCCTTTCAGTGAAGTTCTCATTCTCATGACATTAGCCA
AGATGGAGACTTCGTAATTTGTGGATCCGAGAATGGTTCAGTCTACGTTTGGAACAAAGCAAGGTGTGCTCGCCAGTGTGAGCACTTTCGTGCAGCTTCC
TATCTAACGCTGTTGTAATTTTATCAGATACCTCCGGTCTATGAGCATTGTAAAAAGCAGCAAGCAGGATCGCAACTCCTCGTACGAATTTTTTACAGGT
AAGGTATCATACAATGTGCAATCGAATACGTGGGCCTATTGCTGGCAAGTTCTCACTGGTTTCATCTGCACTCAGCTGCTGAGCCGCCCAATGGAATAGT
CACCGTCGCGTTGTTCGCTCCCGCAAGCACCTTTGCCATGGTGAAGTCCAAGCTCGAGGCGAGCGACGATGTGAATACAAATGCTTGCACGGGGCTCATT
GTGAGCGCAAGTTATGACGGATGCATCAAGTTTTTCGAGCGGTCTGTGAAGAGCGTGTAAGTGAGACAGCAAGCACCAACAAGGCGATTTTAGTGGCAGC
CCTTAAAGTTAGTGGAATTGTGGGGAACCACCTATAGAGCGCAGGGTAAAGGGAACCGTGAAATCCATCCGATCTGTACGCAAATTGTATTACCAGCAAT
TCGTTCTCAGCGATTGAGGCACTCGGCTATCTACCAGTGGTATAGCGCCTCGGTATCAACGAAGCAATCTCTTCTCTTCAAAATAGACTGTTTGCCTGCA
TGTGGTATATTGTGTTCTCGTTGCCTCTATACATCGAAGGCTTGAGTTGGTAAGACGGTTCGCTCAAACTTACAACATTAGAGTACAAGGGTCTATCGTA
TTGCCGATGGCTGCGATTAATTCTCGCACAAACGTCTCGATGTCTTTCTGCGTGGCCTCAATGGTCTCAATTACTTCGTCATGACATGCCGGCGAGCCTT
TCTCTCCAGGGAAAAGAGCCTTATTCGTGATGACGGACAGCCCGATGGTCTTCAGTCCGCAGTGCGCCGCCACGATCACTTCAGGAACTGTGCTCATGCC
GACAGCATCGCAGCCAACAAGTCTTAGATAGCGAGCCTCGGTCGGGGTCTCGTATGTTGGTCCGGAGACGAAACAGTAAACGCCACGTCGAACTTTGTGG
GCCAGACCCATCTTTTCTGCTACACTGTACGCCAGGTCCTGCAACTTCTCGTCGTAGCAGTTGGTCAGAGGTGTAAAACGACCACCAAAACGAGAATCAT
TTGGCCCGATCAGTGGATGCTGGCCCGACAAACCAGGCATGTTCAAGTGGTCGTTCATGATCATCAGGTCTCCGACGTTGAAGTCCGGGTTCAGACCGCC
CGCCGCATTAGTCACCAACAGATACTTGATACCCAGCAGGTACATAACGCGAATGGGCAGCGCCGTCTCGCGCATGGCGTAGCCCTCGTAGCAGTGGAAG
CGACCGCGCATGCACACAACACGGATGCCATCCAGGTCGCCGAACACGAGCTCTCCGGCGTGGCCCTCGACGGTGGATCGCGGGAACTGCGGGATATCCT
CGTACTTGATGACTTCTTGGTTGGACAGGCACTTGCTGAGGCCGCCGAGTCCGGAGCCGCAGACGACACCGACGAGCGGCTTGGTGGTGACGCGTTCTCG
AAGGAATTCGTTGATGACATCGATGCGCTCCTTGGGTACAGCATTGTCGTTGCCACTCTGGTTAGGTGGCTGCACGTTGGACAGGGGGGTCCTGGGGTCC
TTCGTGTCGTTCATCATGGTGCTTGAAGCGAGGTGATCGCGTGCGTACGCGCTGAAGACTGAACTACCGAGCCACGATGGCGCGCAAATTTGCGCGCCAT
CTGTTCAAAATTGTTCAAAAGTTGATGGCGACCAAATGAGCATAGTGAGAACAAGTCAGTAGTATAGCCATGTACTCAAAATCTATTGGCCGGACTATAT
TTGAATACGAAACCGA