Description :
From Genome Similarity Track
Location :
Scaffold_519:4362- 6026
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_519-snap-gene-0.12Cysteine protease family C01A
Pytve_DAOMBR484maker-pve_contig_519-fgenesh-gene-0.2Conserved gene of unknown function

Sequence
1664 bases(100 bases per row)
GCAGCCAGGAGTACGTGGCCGTCTGCCAGAACGTGTCGTCGAGCGAGGCCGCCGCGACGATCGACGGGTGGGAGCAGGCCGTGGGTCCGTCCTGCAACAG
CAGCAGCGACCCGAGCGCGCTTCTCCGGCTCGCACTGCAGCAGCAGCCGCTGTCGGCCGCCATCAACTCGCAGGGAGGCTTCAAGGACTACAAGGGAGGC
ATCTACTCGTGCGAGAATGACGGCGACCTCGACTCGAGCTCGGACGTGGACCACTCGATCGTGCTCGTGGGCTACGGCTCGAACGGCACGACGGACTACT
GGATCCTCAAGAACTCGTACGGCAGTTCGTGGGGCGAGAAGGGGTTCATGCGGCTCGCCGCCGACTCCAAGGCCAACTGCGGCCTCAACATCTTCCCCGT
CATCCCCACGGGAGCCAAGGCCACGTCCTACCACGCCGAGGTGGACGGTGGCGGCGCGGTCGAGTTCAACGGCTACTCGCCGGCCACGTGGGTCGCCATC
GCCGTCGCCATCACGTTCGGCACCATTTTGCTCACGGTCGCCGGCGTGTGCTGCGCGCGCCGCCGCCGTCTGGCCATGCAGCTCGTCAAGGAATGAGCTG
CGGGTCTCTTAACTTATCACGGCCCGCCGGGCTCGCCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGACAGGCTCATACAGTCAGAATAAT
CACAGACATAATAGAAATTGACTGCATCAACATGTGAGTTGTGCATCACCTTCAAGATACGCATTCTTCCCATATCTAACAATTACGACGGGACGATTGG
TTGAAATGGATGAAACAGAGTATCGGATTGGCTGAAATGCAGCATAAATCAGAGAAAGGCCAACGCATATTCGTGACGACAAAGCGCTCTCCAAGCAGCA
GCAGCAGCTAGGCGACGGCAATGCTGCGAGCGCACGAGGACTCGGCGCGGTACGCGGACCCGGCGGCGTACGAGGCCTACCAGGCGCGTGAAGGACAGGA
GCTGGTGGTGTCGCAGCTCGTGGTGGGTGCCGTGGGCGACGTGTTCGACGGTTGGCTGAACCATGTTTGGCTCGCGGGCGGACGCGAGGTGCGCGCCGGC
AATGGCCGTGGACTCGTGGGCCACGTCCGTCAGGTGCCACTCGGCGTTCAGGAGGAGATTCTGTCGGCGGGTCTTCCCAGTAGCAGCAGCAGCTTCGACC
GGATCCCGACGGTGCACTACCGACTTCGCCGGTTCGGTCCTTTCCCGCTCAAGGACCACCTCGCGCTCGTGCGGTTCGTGGACGTGGCCGCGTCGCCCAA
CAGCGCGCCAGCGACGCTCGTGGTGTGGACCGTCAAGTTCGAGCCGTCCCCCCTCGGCTACGTGTTGTGCTGCGGGCTCGTGGTGCGGCTCATCTTCCGC
ACGGCGCTGCAGTTCTTCCTCGCGCAGCTCGCGGCCAGGCAGTTGAAGCTCCAGCGACTCGCAGAGTGCTCCAGCTCTGCGTCTTGACTCACGATAGACC
GGCAGATGGACAGACAATGCCGCTATGATGCGGGATAAAGTATGAAACGCGACTGGGACTTGAAGAAGCTGCGGCAGCATGTCGCGGACTGTGTGGTTCT
CTGCGTCAAGACCGGGGAGAGACGGCAACGGCTCGGTGGCTCCCACTGGCACCAGGTGCATCGC