Description :
From Genome Similarity Track
Location :
Scaffold_113:43611- 47964
Transcript NameFunction/comments
Sapdi_VS20SDRG_16110hypothetical protein
Sapdi_VS20SDRG_16111hypothetical protein
Sapdi_VS20SDRG_16112hypothetical protein

Sequence
4353 bases(100 bases per row)
CAGCGCGCCGCCGACTACTGTGCGTCACCGGCCTTTGAGCGCGTCTTCGAAGAGTTCGCCGAGTGCGCTGCGTCCCGTACCCAGCACTCGCTCAATTGAG
AAATGTAGGGAGCATGCGTCGGCGTTCTATGATTCGGTCGACTCGGACGACGTCGAGCACAAGCACGAATACAAGGAGTTGCACGATGCCTACCTCAAGA
TTTTTGAGGATCGGCTGCAAGGTTTATCGAATTTTGGTCTTATGAGGACGCTATTGAAGTGGAAATTAGGGTTTCTCGAAGACGAAGGCGGGACGACAGC
GCAGTTCTACGCAGCGTGCAAGGACATTCTCGATGAAAACGACGACCACGGCGAGTACACGTGGTTTGTCAATCGTCTTCTCGCCTCTATGGAGTACAAG
CTTTTTTACGGTCTCATGCGCAACGAAGCCCGGCAGCAACTCCGTCGTCGCAAGTAAAAAACGAAAAAATGCAGCTGACAATTCTGTACATATCCTAGCA
CTCTCTTCAATGAAATGGTGGTTTTGTTGGACGAGGGGACCGCACAACGCGCACACAGAGTGCTCGCGACCGAGTCGAACAGCTGGAAAGAACAGCGGTG
GCCTTAAACTAGTGTAGATGGCAGCGCGTGGACAGCGCGCCAAACAGGGGACGTGCAGTGTTGTGTTGGTGAGGATCCATCCCTTAGGCAACCGTTGGCT
CTTGTTGACGTGCGTACTCCTCTGTGCTTGGCTTATACAGTTGATGCTCGTGTGAACGTGTGCATTGATTATGATCTTGCGATCGGCATGCAATGGTACA
GGCCCACGTCGCCCTTTCAAGCGACATACCGACGGTCAGAGCTTCGGGACGATGTTTGCGCTAAGCGCTGGGCGTCCACATCGAGCATTGACACCAAGCT
CACTTTTTCAAGACACCAAAGCACGCCTTTTTCAAGGTTTACGGGCACACTATACGAGGAAGCGAGTGCGTTCGGGGATGACTCGCCGTCGTCAGAGGTC
GTCTGCAGAGTTTGCGCCTCCAGAAGCTGCCTGCCCTTTTCCGATCGCGGGTACCCGTCAATCATCCGGATAAAATTGTGCCCCGGTGTACAACATTTCT
CAACGGCGATTTCTTCTGCTGTAGACCTCGGTCAATGATGGGACGCAGTGTTTCGGACTCTCCAAAGTGTCCTCTATCAACATGCCAAGTTTCAGCGAGT
TGGTTTTCAAACGTGATTTGGGCGATTGCGAGCCCTGCGGCGGCGACTGCCACGAGCTTGTCGGCGCGGATTGGCCGAAAAAGAAAATTAATTACACCAA
TGAAAGAAATTAGAAATATAATTATATTACAGTGTGGTCTCAAGTAGAACGCGTATTATTTTAAGCAGACTCGTATCGAGGCCAAGAAGGCTCTAGGTTG
GAGCCTCAGTTTGGTCGCATCTAAGTGCAGCTGTACACGTTGGTCTTCTTGTATGAGTGATTGCACAACAAGCAAGCAGAGTGCCCACGAGCGAGGCACA
GCTGGAAAAGACAGCGGTCGCCGTCCAATGCCATATTTAACCACAAATAAACAGTGTCCAAATGCCACATTTAACCACATTTACGCGCAAGCAATTTTGG
AATTGGCAGGCATGGCGACGGCGACGGGGTCGGGGACAACGTCGCCGACGGGACGCAAGCGCCGGCGCGAGAGCATCGAGGTATCCGCTTCGCCGTCCAC
GCGCGAGCATCCTACGGCCGTATGTAGGCGCTCGAGTGCACGATCTGCTGCGAGTTTTGCACGACGCAGGGCGACCACCGGCTCGCGAGCCTCGCATGTG
GCCATTTTTTCGGCCAGAGCTGCATCGAGCGCTGGGTCAAGACGAGCAAGACGTGTCCAATCTGCAACCGGGTCGTGAAGCGCAACGACGTGCGCATCCA
CTTCACCGATACGATCGCGGCCGTCGACAATGGCCGCCAGGAAGAGTACAACCAAAAGTACTTGGCCGAAAAACAGGCTCGCATGCAGGTACATCCCGTA
AGACGACGACACGGACGATGCATCTGCATGCGCTAGGCCGAGATGGACGTGGCGCGGCTCAAGCTGCAGGTCTCGACGACCACGCAAGAGATCGAGACGC
AAAAGCAGCGCATTATGGAGCTGCTGGCCGAGAACTCGCGGCTCAAGACCGCACCGATCGTTCTCTCGGACGACGATGACGATGACGATGACGATGACGA
TGACAAGGATGAGGACGAGGCGGACTCTGCTTCCCGGCTCGAGTACACGCGCGTGAACGACGTGCCAATTCCTTGCATGGAAGCCCGCGTCTGTGGCTTC
TCGTCGACCTGTGACATGGTCTGCATTGGCACACGGACGCATGTGTCCAACGACGAAGGCGCCCAGCATGGGCTGCTCCAGGTATCTAGCTACATATCCC
TTGTATGAGAGACATATGATGATGGCGTGTCTAGGTGAGTACCGTGGACGTGCACCACCGCGTGTCGATTCCCTTACACAAGTCGCCTGTCCGCGACCTT
GCCTTCTCACATGACGACGCCCTTGTCGCGACCACAGCATTTGACGCCAAGCTCCTCCTCGTACGCGCCTCCATCTTCTCTTCTTCTAGGACTCTGAGAT
GTCCTATTTAGACAAGTACCAAGTCCCACACGTGTGTGCTCAAGTACAACCTCCCGTTTCCTGGCTGGTCGTGCACCTGGGATGCGACCAATCCATTTCT
CGTACGCCCTTTCTAGTCGGGTGCGCAACGAGAATGATGCGACTGGACTGGGTGTAGGTGTACTGTGGTCACCACAATGGCCAGATCTCGGTATTTGATA
TTCGGCGCACCGGGTCGCCCGTCCAGAATCTGGCCCACCAGCTCAAGCAGCCTGTGCACTCGATTCGCACCATGCAGCACGGCAATACCAAGGTACGTCA
ATGTTCCATAGTCCTTTGTTACTAAAAATGACATGGTTATAGACTATTGTGGCAGCTACGTTTACAGGCGTGTCGATGTGGCATGCGCCGGACGGCGTCA
CGGTCCCGACCGACCCGAGCTTGAACATGGAAGTGAAAAATTGCTTTTCGATGGGCCACAACCAAGTCCGGCCGACGCAGCTCATCGTTTCGACGCGGAC
GCAGCTGCCGTCGTCGCCCGCTCAGCACTTTGTCTTGTCGGTGCAACACACCAGCAACCAGCTGCAGACGGTGTCCGATGCGGTCGTTCAGGTATCTTGT
GAATCTTCCTCAATCTGAAAATGAACCAATGGCGCTGGATAGGGTCACCGCACGCCGTCGGCGCTGTCTCGGTCGGCCATGTGGCACCTGCCACGTCAAG
GCAGCCCGGTGGTGGCGTCGGCCGATGACGAGTCGCACCAGCTGTGGCTCTGGAACACTACGTCTGGTACCGTTGTGCGCAAGCTCGACCCAAAGCTGCC
GTCGTCGATCGTCGATGTTCAGCATGGGATTGTACCGAATGTGGCGGCCGAGCAAGGCTGGCTCGCCGTCATGAGCAAGGAGGCGCTTGTCCTATACAAG
TCGACGGCGTCCCCCCTTAGCACCCAGCGCCCGTCGTCAACGTCATTCTTTGCTTCTCAAGGGCGGCCAACCCAGCGATCGACGGGATAACGCGGTGTTG
ATTTTGTCCATTTTCTCAGCTGTCAGGCTGCCACGTGGATCGCGCACCTGATTGGCCGGCCGGTGTTTTACACAGTGGTATTTATGGAGTGTGTGTGAAA
TATATTTCCCACGTGTGTGCCAGCTACTAAAAATGGCACATTGGCCGATAGTTGTGGCACGTGTGGCAGATAAATTTGGCACTTGCGCATGATGGCGGCC
ACCATCGTCTTTGCATGGGGCTCTGGTAGATGTCATTGCATGCTGCAGCCGCGCTCATGGTCCAGTAGGCTCGGACGGACAGCTCGGCCTTGGCGACAGC
GCGGACCACGCCGAGCCGCGGCCGCTCGATCTCGGCGCCTTGCAGAGCCCGGTGGCGCTGACCACGGGCGGCTGCCATAGCGCGGGTACGGCGTCGGTGC
TATCTAGGCGCTCTTGCTCAACGCTATTCTAGCTGTGGATGCCACTGGCGCGCTATACATGTGGGGCAGCAACGCCCATGCCCAGCTGCATCTTGACGTT
CCGACAGCGCAAGCTCCTGTGAAGATCGCGATCGAGGTACGCAGTGCGTCCAGACCGTGTCCAAGTGACTTTTGTCCGTGTAGCCGCGCGTCGCGCTTGT
GCGCTGCGGCTGGTCACATACCGTCGCCGTTGCCACGCACGCCGATGGTCTCTCGACGGTCTACAGCTGGGGTAGCAACCAGCACGACCAGCTCGGTCAG
ACAACGACGTCGGGTGGGCTCTGGAAGCAGCTACGTCCGCACATTTCCTCAAG