Description :
From Genome Similarity Track
Location :
Scaffold_950:4361- 6816
Transcript NameFunction/comments
Phymu_g12413peptidyl-tRNA hydrolase, putative
Phymu_g12414calcineurin-like phosphoesterase, putative

Sequence
2455 bases(100 bases per row)
ATGGAGGACGTGGCCTGGAAGTGCACGGCCGCCTTCGTGCTTGGCGCTGCAACGCACTACTTCGTATCTTCGTACCTGTTAAATGACACGACCAAGCCCT
TGAGCAGTAGCACCaaggacagcagcagcgacgcggAGCCTCGCTCGCCTGCCTCGTCCCGGTCCTCCTCCGGCTCCTCCGACGACTGGGAGGGCGAGGA
CTCGGCCAGTTGGGTGCCCCACAAGATGGTTATGTGTGTGCGCACCGACCTGAAGATGGGCAAAGGCAAGATCGCGGCCCAGTGCTGCCACGCGACGCTG
GGCGCGTACAAGCGCGCAAGCAAGCGGACGCCGGACGCCGTTCGCGCGTGGGAGATGCTGGGCCAGGCCAAGGTCTGCCTGAAGGtggactcggaggagg
aaatgCTCGCTTTGGCAGAGAAGGCGGCTGAACACGGACTTGTTAACTACGTCGTGGTACGTTAACTGCTTGAGATGTGGCTGGGATGTTTTTAAACTGA
TGTTTTCGTTTTCTTTTAACAGATTGACGCTGGAAGGACGCAAATCGCGCCCGAGAGCAAGACGGTGCTGAGTATTGGACCGGCACCACTGAAGGCTATC
GATGAGGTCACAGGCCACCTTAAGCTCATGTGAACGCGCTGGGATTAAACTGGAAACAGTATCTTTGATTGAGTGGTTCCACGATCTTTACATGTGTACA
GTAAGTATATCATGCTTTCCTTCCTGCGTGATGACAGGTAAaaagatgctgcagctacagcgTTGCGACGGTGTCGTACTGCGAGCGGTTTTTCAGCACA
CCAGCACGTTGGAGGATGAACACGGTCAATGCCACGCACGCCACTGCTACGACAGTCGCTAGCGCTGTCGCTTCGATCGTTGTCAACACGTCTTTTGTCG
CAAAATTGGTGTCCGAcgcgctggaactggacgaggtCACTGCAACCACGTCATCCACGTGGCCAGCAATCATCGTTTCTGCAGTGTCGACACAAGCCAG
GTGCTCGCCCTTCGTAGTCCACCACTTGAGCGTACACAAAGTCTTGGCATGACAGGCTGCGTCCTTGCAAGGGCGAGCGTTCGGTGAGCGAGCCTTCATG
TTCAAGTAGTAGTCTTCCACTAAGCTCACGTTCTGCTCAGCGCGCTGCACAAAAGCCGAAAGTTCGGACAGCGATAGGGACTGGAGGCCATAGGCCTCGC
TTGCCCTAAACAGAAGCTTCCAGTCGAGTTGAGGGTCACTCTTTGCGATGTAGGAAGCATACACAGCATAGTCGAGCACCTCGTACGTCTCAGTATCGTA
CTCCCAGACCATGAAAGAAGGATTGTTGCCGAAAAGTGGCGAGATCGAACCCGTAATGTACAACGGCAGGAGCTGAAAGGGGTCGTCCTCACCTGTAGGC
CCATCAAGCGACGTCACAGGTACACGGAACTCGACACTATGCACATGGCCAAAGAACTGTGCCTTGATCACATCGGCATATTTTCCGACGATGTTCTTGT
ACTTCACGATGTACTTCGTGTGCCACTGCGGGTTGCCTCCGTACGAGTCCACAATAGGAGCGATGTGACCAGCAATGTACGCGAATTTGCCGGCATCCTG
TAGCTCTGCAAGAGTCTTATCCAACCATGCAAACTGGCCAAACGGATCCGGTTGCTTGGACGTGTCAGGCACATGACTCGGCTGCGTATCACACAGAAAA
AATTGTCAGTACTTCACACACATCTAGCAATCGTTTTAACTTACTGAGTAGGGCACCGTATTCAGCGTGATCACGTGCAATCTGTCGTCCAGTGCATAGC
TCAGAAATCCACGTCGATTCAGCAGATCCAGGTTCGCTGCTGACAACGAGCCTTCCCACACCTCGGAGATGATCTCAATTGACGGgttcgtctccgtctc
tgGGTCTGTCACCAGCATGTGGTAATCCGGGTCTGTCATTAAGAGCAATAACACATTAGTCTTCCTCCTCATATACCAATAACCTCTGGCTGCTTCCTTA
CTCCCGTCTGCGTTGCCAATGACGGCCGTGACTTCCAGCTTTCTGTCCTGGCTTTTTGGCGGGTAATAATTCTCCATCGTATGGACATTTGTCTCCACGG
CTTTAGCAATATATTTGTCAGTGAATAACCCGTGTGCCGCGTGGTCTCCTGtgtacaagaagagctcaGGGTCGGCCACCACGTGCTCTTTGGCGTATAC
CAGCGCAGACTCGAGAAGTGCCAAAGGAGCGTCTTGGAAGTAACAGATGGGGATGCGAGCGTTGTCCGCAGCGGAGAACGACTCCGAGATGTTCAAGTGC
ACGTCCGAGAAGTGCAGGATCCGCCccgcagacgctgcagacgccgGCGCAcacagcagcgcaagcaaCGCCAGCCCCAGCATAATGCTTTGAGGAATCG
TAGAATTCAGCAATTGTTAAAAGCATTTGGTTTTACCACTTAAAAAACTGTTTTA