Description :
From Genome Similarity Track
Location :
Scaffold_466:4361- 18281
Transcript NameFunction/comments
Phyke_g9703hypothetical protein PHYSODRAFT_354949
Phyke_g9704hypothetical protein PHYSODRAFT_259266
Phyke_g9705hypothetical protein PITG_14592
Phyke_g9706choline-phosphate cytidylyltransferase B
Phyke_g9707hypothetical protein PHYSODRAFT_286562
Phyke_g9708sporangia induced hypothetical protein
Phyke_g9709conserved hypothetical protein
Phyke_g9710hypothetical protein PHYSODRAFT_561976

Sequence
13920 bases(100 bases per row)
GACGACACGCCATGGGAAGGTGGCACCTTCAACCTGACACTGGAGTTCAGCGAAGACTACCCGAATAAGGCGCCCACGGTCAAGTTCATCACGAAAATGT
TCCATCCCAACAGTATGGATACAGTACTCTTTCATATTGATTATTTGGGTTGTAATCTAATTGCTTTTTATTCCTTTTTGGGTGGATATAGTCTACAATG
ACGGACAAATTTGTCTGGACATCCTGCAGAACCAGTGGTCTCCAATCTACGATATTTCGGCTATCCTGACGTCCATCCAGTCGCTATTGTGCGATCCGAA
CCCGAATTCGCCAGCCAACTCGGAGGCAGCGCGACTCTTTCAGGAAAACAGACGGGAGTACAACCGCCGTGTTCGCGAGATCGTCGAGCAGAGCTGGCAG
GCGATCGCATAGGCGCTCAATGATTGAAAATGTGCCGCAGATCTTCGTTGTGCTACACGGCACTCCACTGTGTGCCTTGTGTCCATTGCCACCATGCAGT
GTACGAGACCACAGACAGGAGTGGGCTGATCCGTACGGCCGCCCCCAATCGTGTTGCCTCTTAGAAACCAGAGCAATGGTTGCGTCGTGTGTGGCGTGAA
GAGATGTTCACACAACGTAATCCACAACAAAACCACAAACGATAAAGAACAGGAGGACACAAGCCAAAGGTAGTAGGGCATGCGCGATGGATGACAGCGG
ACTCAGTTGAATAGGTGTGTACGAGGCAGTGGAAGGAAAAAACGAACAACTGAATTAAAAATGGATCCAAGAATGCCTGGGCATCATGTTATACTCGTTG
TGGTAGACTGTTTGTTGTGAAGACTGTCATTACTTCGCGAACGGCGcctctgcagcttcctccacGGTCTCAAGCAAGTCGTTTGACTCGACCTGGACCG
GGTTGAACTGCGGCCTGATCGTGGTTGCTCTGATGGAaccagaggcagcagctgacgCTGCGGCAACGCCGAACGAAGAAAGTTGAATATCGCAGCCTAA
ATCGCGCAGAGCTGCATAGGCCTCGTCGCCACAGTCACGGTACTGCTGTGCCTCACGAAGTATAGACTCGATATCCAGCTCGTCCTGCAGGAATCGCGGA
CGTAACTCCACGCTACGAGCCACCATGTTACGCACCGCCAAACTGGCTTGGCGTAATACTGCCACATCGCGGTGGTGAGCCTGCATGGCTCTCGAGATCT
CGTGCACAGCCCCGAGCTCCACAAGTGTGTGGCTGTTTTCTGGAGAACGGAGCGCAATCGCAGCTAGTGTGGCACAAGCGTTCTGTTGAATGGACGCATC
GGCCTCGTGATGCCTCATGACCAACAAGGTTTGCTCGACACCACCAGACTGCAGGATTTTGCGCTTAAGGTCATCAGCTGCCGCTACATTCCGAAAAACT
GTGATGCAGCGCTTGACCACTGGTGCGTTGTTCACATAAACCTGCATGACTTGCTGCACAGTAGTCAGGCCGTCCAGATCGGCGATCTGTTGACAGTTCT
CTTCCGTAATGGCAAGTTGTTTGAGAACTGCAAGCCAGTTGACTAACAGTTCCGGTGACGTATTCTCCACCTGCGTCGCTGAATTGATACATTCACGCTG
GCGCAGCATCTCTAAACTGTATGGGATCATATCACGCTCAACAAGAGCCTTGATGGTATCTTGTGCTTGTGAAAACGTCGCCCGTGGATCATCATTGATA
GTAAGTACTCGGAAGCAAAGCGCCAGCTGCTTCGACAGCACTTCATTCTGTCTAGCTTTGTCTAGGTATCCACAGAGCACTTCCACACCATTTGCCTTGG
TGAAGTGCGTCTTGTTAGTCTCATGCTTGACGCAAACAGCCTTCACCAGTCCCAACAACTGCACTGAAGTCTCCACCTGATCTTGTTGACGCTTCAACAC
ATCAGCAAGCCGTTGTAGACCTTCGACACCTACAAAATCTTGATTATCCGCATTATCTGCACACAAAAGCACTAGTAGTGCACTGCAGGACGTCACCATT
GCAGCAGATTCAACATCCAGCAGAGACACCAACGTGTCCACGCCGTCGTTCCGCCCCACGACCACGCGAGCCTCCGGTACCTCCTCACAgaccttctgca
gctcagcCACAAGACTCAGCCCTTGATCCTGTTGCTCTTGATGCTTAGAAACCTCCTTCAACTCAGCAATCAACCGCTTCAGTCGTGCAGGCAGCGGCTC
CTGACCATCAGAGGACTTCGTTGATCCGCTCTTGATGATATTAGACAGGTCCACTCCCTGAGACTCGAATTGCTGCACAGCATCGGCCACTGCCTCCTCC
GGCGACATGTCAAAGTCCTCCACGTTCTCCGCCACGCACTCATCGAACGTCTCCTGCGAGATCTGCTTGCGCACAGCggtcgtcgtcatcttccaacGAC
TGTTTCTAAATGTGTTAAACAAATTTCTAACCATGTGGATACGTTTCTAAATGAACGCTATATTTCTAAAGTTGGCTCATTTTTGAAGAGAGATCATGGC
GATAGGGAATGACAAGGACGCGGTGCTGGTTGAGGGCGTGGAGGCGCTTGAAGAGTATCTCAATGACCACGAGATCGCGTGTGCCAAGATCAAGCAGGTA
AGTGTTGCGTAGACGATTCATTCACCAGCAATTGAAGCAGAACTGACGCTGTTGTGATTTTTTTTAGGGATTTCTAAAGCTGACGATGGCAAGATTGCGT
CTGCCACCGCATGCGATCAGTGAAATTTCATACAGAGAAACGTTCCAAGCCTCTCGAGTCGTGGAAGAGAATGGTGAAGGGGATTGGCGACTTCAAGATG
TCGCTAAAGTGGAGCAGAAGGAAGTTAATAAGAGTGCCAGTGGCGTGCTGCACCAGAGAGCTGGGAAGGCAAACAAGAAAGGTGGAGCGGAGGACACTGT
AAATATCAACAAAAAAGACCCACACAGagagacgctgctgtggttcAGTTCGTTGCCGCCGAGTGACCTCCGCCAGGCGCAAAAGCAATTTGCTAGCGGT
ACGTTGGTGCCGTTTCTGTTGAATGTTGAGACTCGTGTTGTGATTGAAGTGGTTGTGTATCTTTTCGTAGGATTACAAGCCTTGCTAGTGGCTGCTGAAT
CTGCTAGAAAGGTCCAGGTTATTCTAGCAATGCGAAAGTGATGCAGCCCACTCTTCCTTATTCGAAACAATTCTGCATTGAGTTTCCCGTGGTTTAGCTG
CCTATGCATCAAAATGAAGTGACGTTTTTGCTCATTCAACCTTAAGAAGAGCATTATTTAGGTGCGTCAGCGCAAAGATGCCACAAGTGAGCACTCTTAG
CAGTTGAGCAGCCTAGACTAACCCATATTGACATCGGTGATAACTAGCGTCACGGCCGAATCCAGTGTGCCAACTCGACCCCTGTTATTTATTTAGCGTT
TTGCAATCATAGCAGTTAACGTTTGATATGCTAGCTACACAGACTGTCGGAGACCGGGGCTTTGGTGATtctttcgctgcagcattcAACAGAGGTAGAG
TCAGTTCCTGTAAGCCACTCCATGAAGTCCAAAATTCCAGTTTGTTTGTCAAAAACTGATCAACGTACCAATCGGCCTTCACGCCCAAACAGGTCTGTGA
AGTGCTGCCTCACCTTGCCCATCGCCATATCGAACTTGATACTCTTCTCTTTGATAAAGGATACATTCATCTCCTTGCCAGTATAACCGCGCTGCAAGTT
ACGACGGATGAATGTGTCGTACTGAGCAATGATACGAATGATCAGGTCCGATGTCGAAATGCCGTCTGTGCGCTGAGTCTCGTGGAATTTGCCCATAGCC
TTGATGCGAGCATACACATCTCCCTCTGACGCCTCTCCCGAGGTATCCGAGTACGGCAGTGCATCGTGACACACGTAGTCGATCTGGTGTTTCTCCAGAA
ACTCGTCCGACAGCACCCACGGCGCGtcctccaccacttcatctACCCACTTACAGTGGCGCAGTGACTCGTAGCGCTCCTTGTCCGTCATGACCGTACG
ACCCTTGAGCTTGTGCGTGATCtcgtcactgcagcagcccACGATCAGGTACGTGTTGGGGTAGGCCTCCTtacactgctgcagagcctTGGCATGACCG
AAGTGGAAGAGGTCGAAGATGCCATCGGCATAAAGACGCAGTGGACGGCCAGTCTTCGTGCCGGGTTCACCTTCTACAGGCGTCTTTCCATTCGGTGTGG
AGATCTTTGTTTCAGCTGTTTCAGTTGTTGTCGCTAGGTCCGTATCATGAACGTTGGCTGTGATGCTGTCCGTCTACATAGGCCTCGTCAGATACAGTTA
GCGAGAGAGCTGAGCTATTGCACGATAGAGACTTCGTGTGTACCGGTGCCATTGTGTAGGGTGTTATCTAATACTCCGCTGTAAAAATGAGGAATGGCTG
CAGAGGTCGGCGAGTGGCTGTTGACGACAGGCAGCCCTAAGTCGTGGCAGAGGAAAGTGTGAGACGTCCTCACGACGTCCATCACGAACAGCAGACATGT
AACGGCACTGGACGTTGATGCTCAGAGCTTCCCACTCTGATAATTCTGTCATTTCaaattgattttttttttattatgACCAATCTGGCGTTTCAGAATC
ATTTCGGATCAGACAATGACGATAAACCACGTCGTGCAGCCcggcgacagcagcggcagcgtgCTCGTGGCAAGCCTCGCGAGCCGCCACTTCCGTCCCG
GAGGAGTCGTCAAAGGTGTGATAAGACTCGTGAGCCACCAGGCTTCCCCTGATGCGCGCTCAGAGATCGCTCACGTCGTCGCTCAAGTCCATGGCCACGT
CACTGTAGACAGCAATCTGCTGACTCTGCCAGTGGTTCACGTGCAATCGCCCCGTGCAGCATCTCAAGAGGAACGAGCGCAGCTGGAGCACAATCTATCA
GAGGACGTGGTGCCGTTCTACAAGACTGGGGCGTCGCTTCCTGACGTACGCACGTTCTCGGGGGACACAGGCACGTGTATTTTCCGTTCGGCACCGTCAG
TGCTGCTCTCAGACATCAATATCGCCCCCACACCTTCAGAATTGACAGCAGCCGCTTCCAAGATCCATGGGGCTACTGATGAAGTtattgaagctgcaag
gGAGGAGACAGCAGAACGCTGTACAAGGGAGTTCGCTATCGCGCTGCCTGAAAACATTTGCCCAACGTTTCGTGGTTCATCAGCGAGGGTTTTCTACGTG
GTGTCTATCACAGCACAATGTGCTCTCAATGATAGCAAACCAGTTTCTGTGCATTTACCGTTTGAAGTGTACGGCTCCGAGTACTTTTTCGTGCCTAATA
CAGTGGCTAGTGCCAACCAGATCGCGGCAACCCATAGCAAAGATGATGGTGTCACTGGAAGTACCGGTAACAGTATTGAGAACGCGCCCCACAAGGACCC
CGTAGTGGGAGGTTCCAGTCGAGTGGGCAGACCAGATCGAAGTGTGTCTTTTTCACCAGCTCCTGTTGGAGTACGCAATGGGAGTGAAATTGCGTTCGAG
CTGCGTCCCTCGCTCATGCATGGGCGCGTGGAGACAGAGTTGATGCAGCGCGCACAGACGAGCATCTTTACAATTGGCAAGgacagcagccacctcgTGC
GCTTCCTGCTCACAAAGCAGTTCTACCAGCCTGGAGAGGTTTTGCTAGGCGTGTTTGACTTTACTAGGGCCAGCATCCCGTGCTACGAAGTGTCGGCCAC
GCTCTGTTTAGAGGAGACGCTGTCGTCCATGGCGTTGGATCCGGATCGGGTGGTGCAGTCCAAGGTGTTCGGCAGCTTCCGAGAGCGCACACTGGGCGTG
CTCCAGACGAACATGCGCTTCAGCATCCCACATGACGCACTGCCGACCATCCGTACAGATCTGGTGCGTTTCCAGTGGCTGCTCCGCTTCGAGTTTTCCG
ctggtgcaccaccacaaggTCAAAGTGGCGGCGCAGCGCAACGGCAGACGTTCCAATGGCAGGTGCCCATTGTTGTGCAGCCGATGGTGACTACGGAGCG
CAATCAGCTCGCCAACGTGCCGCACAAGCTCTTCTCGGGCAGCACCCGCGTGGCGTCACTGTCGACTGCAGCGTAGTAATGACTTGCACTATCGCATAAA
CCTCCCTATAGTCAATATGCACTGCATTTCATTTTGAGCCAAGCTTAAGCATTTTCGCACTGTTTTATGGCATACACCTGGTAAATCGCATATCCAGAAG
TGTAGCCACCCACGTCGCCGCGTCACACACAGGATCCATTTTTCACAACTAAACGACTGTACACCGGAATCGTACTTTATAATGTATACACTGTACTCCA
CTTCGCTTTATGTGCGTCACTTCAGTAAAGGAAAAAACCAGGgggcaagaagaccaagcaCCATGGCCAGAAAGGTGTGTGTGTTCTCTCACGCTTTCTC
TTTGTATACGGCAATCCCCAGGATATGACAGCGCCCCATCGACGCGCGAGTGTCTCCCGCGTCCATTGACGTCCCTATTGTTATCTAACAACGCCTCGGG
TTTAACCAATTCTAGATTCTAACCTGTTGATATTTTGAATGTCATATACAGAGACGTGCCACCGAGATGAACCatgaggaggaggtggaggaagaccACC
ACGCGCCTAGTTCCGAGGAAGAGGCGAAGCCTTCAGCTGACAGCGCAAAGGACACGGCTAGCAATAGCAGCCAAGAGGGCGATGGGGAACTACAGCCCGA
GCCGGAACCCTACCGCAAGACGCTTGTAGAAGGTGAACCCGGCACGAAGACTGGCCGTCCACTGCGTCTTTATGCCGATGGCATATTCGACCTCTTCCAC
TTCGGTCATGCCAaggctctgcagcagtgtaAGGAGGCCTACCCCAACACGTACCTGATCGTgggctgctgcagtgacgaGATCACGCACAAGCTCAAGG
GTCGTACGGTCATGACGGACAAGGAGCGCTACGAGTCACTGCGCCACTGTAAGTGGGTagatgaagtggtggaggaCGCGCCGTGGGTGCTGTCGGACGA
GTTTCTGGAGAAACACCAGATCGACTACGTGTGTCACGATGCACTGCCGTACTCGGATACCTCGGGAGAGGCGTCAGAGGGAGATGTGTATGCTCGCATC
AAGGCTATGGGCAAGTTCCTGGAGACGAGGCGTACGGACGGCATTTCGACATCGGACCTGATCATTCGTATCATTGCTCAGTACGACACATTCATCCGTC
GTAACTTGCAGCGTGGATATTCGGGCAAAGATATGAACGTGCCGTTCATCAAAGAGAAGACTATCAAGTTCGATATGGCAGTAGACAAGGTGCGCAACGA
CGTCGACTTGTTTGTACACAAGTGGATTAACAAGGCCGACGAGATGCAACACGGCTTCACGGAACTTTTCAGCAAGGAAGGCCGCCTGGTAAGGATCTTG
GTATTTTGGCATGGATTTGATGGTATTTATTTGTGATCTAACGGTTGTTATCTTTGTGTGATACTGTGGTTTATTAGCGCACATCGTTCCGCAAACGCCG
AAAGATTATCAAGGAGCGTTTGTCTGAACGTATGTCCGAGATGGCACGTGAAGGACTGTGCTAAGAGAAAAAGCGCGGCGGGTATCCACGAaaaagctgc
tgtcgagcaTTGACTCAAGGTAGCTCAGGTACACACGCAGAGGCCAGACTCCATAGCTCTCTTGGGCTATTGGGTTGGATTTGTGCACCTTGGTTTGTAT
GGCGGATTGCACTAGTTAATTCAGTTCGAAATGATACCATATGCGCTTTCGCTACGTGTACCCGTGCTGCTTCATGCTATGTGTAGCAATATTGAGCACG
ACGCGCACTTTTCCTGCGGACGTGACGCGTGTTACTTCGCGGCTGTCACTTTGTGCCACGAACTTCGAGTCGAAGTACTCGGGTGGTGATCCTGTGAGCC
ATGCGATGAATTGTTGCAACgtggacgacgacagcggGCGAAACAGCGGCACCTCACGAGTGACACATCCTGTTGTCACGGGGAAGACGACAGATCCATA
GCCACGCACCACGTCGCGTCCAAGCAGATCCAGTCCGTACACGCTAAGTACCAGGCGCGGCCAGCCGAACGGGTTGGTGCTCTTGAAAGATACGTCGATT
GGGAAGTTGAGCAAAATCTCTTTGTCTCGACCGCCCAGATACGCGATCTGTGAGAGTCCATTTTCAGCTCCCTACAGGATGAAATGCCACAATATGAGCC
AGTTAGTTGTCAGGCGGAGAGGTTATTCAGTTTGCACACTTACATGAAGGACTCGCCAGTCGACGCCGTAAGTGATGGTGTATCGACAGTAAACGTTATC
CACGCGGGGGTACTACTGTCCACCGCATTGTGTAGTTAGTTACACAGCTTCCCATTTGCCTACAGCTAAGCTAGAAAGAAACGTACACAAACACTTTGCA
CTTGACCTGAGCAAATGACCTGaaacccagcagcaggctgCGCCATCGGCATCGTCGTTGGTATTGGtttcactgctgctgatgtatTGACATGTTCCTC
ATCTTGGTTGTCcgcttttcttcttcgaagGCGCTCCAATGCTTTACCTACGGCGTCTTCactgcctgctgctgttgccattCTTTCCCTCTTCAAGTGT
AGCTTTTGGTTGCGTCGCTTCAAATATTGACTTCATGGTAGTCATAAAATATCCCCCGTCACGAGAACCGAAAGCGACGGCCACACAAAGCAGACGGACA
GATCGGATGGAGTCGGCGGACGAGCGTGCGCTGCATCGCGAACTGCAGGAGTTGGCCAAGAAAcgcgaggtgctggagaaatCAAGTACGTCTAGATCTA
TTATTCCTACGGCTTCCTCGGTATTTTAACGTCTTTATTGCTCTATTGTTGGTAACTAATCACATTGCCTTTGTTTGCGATCTTTTAATCTCTTTATCTG
CGCCTTTCAGAGAGACGAGGGAGTggatcagcagcaggaggagtGGGTGGTCGACGTAGTGTGTTTGCACGCCTTGGTGACGAAGTGtcacgagctggag
gagctcgacAGACGCAGCTGAAGGAAAATTGGGCAAAGGGCAACGCTTCCAGGAGGCTTGGCAAGCGTGACAGCGACCGGTTTGATGCAGACAGTGCCCA
AGATGGAGCAATTAAGAGACAACGACTGCACTCTGCAGTGGCCAGACCAGAGGGAGGCCAAGGGAGGACGGAACAGAGGAGGACGTCATCTACAGCAGTA
ACTACGTCTGCTGACAACGAGCATGCTcagcagcggaagcagcGTGCAGTGGCGCCGTACGCGCAGAAAGAAGGAATTGCGCGTAGTCGCCGTATGTTTG
GCGCCCTGATGGGTCATTTGGGGAAGGCGAAAGAGCGCATTCAAAAGGACACTGACCTGTTTAAAAGGCAGGactcgaagcagcaggaggcagAACAGAG
ggagaaactgcagagtCAGAATCTTGAGACCCGTGCACGTCGGGAAGCAGAGGTCACGCGACTGGAGGCTCTACTGGAGCGTACAGAGTTGGACCGTAGT
GAGCAGATAGCACGAGCTAAGCTAGATCACCTCCAAATGGTTCGGAAGAGCCAACACCAGGCTAAATTCCTGGTGACGGTTGCTTCACCACCCATTTACT
ACCTCCCAGTGCGCCACACGAAGGACACAGAGGACCTGCTTGCTGCATCCATGGAGGCTTGTGAGGCAAAGATGAAGGCTAGCTCACGGACCCACGACGA
GAAGTTGCGTAAGCTGGAAACCGAGTTTGCTGTTAAACTGGAACAACTCCGTGAAGAGTTAGAAGTGGCCAgaaaagatgaagaggagaaggtCGAGGAG
AAGCCAAACGATAAGGAGGATGCGATGGAAGTCGAGGAGGACGCGGTTAGTCCCCGCAAGGAGGCAGCTAACGAAGACATGGCTGCTTTGAGTGCGCTAC
CTGCAGTGTCGGCAATGGAAGTTGAGGAGACTGTCCAGGAAAGCGTGTTAGGGAGTGATCTGGGTGATAGCCCTGTTGAGAAAGCACACGACAAAACTGA
TGGTCCcaatgatgatgacggcGAGGTCAGATCGGATTCTAGGAGTGGTGACGGTGGGGGAAGGAAACTTGCGGCGGCGGCAGACAGAGAGGAACCGAGG
GTTAACGAATCTGAAGTTGGATCCGCATCGTCGCGTGGGGACATAGAGGAAAGTCAGAGTGCAGCACAGGCCAACAAGGAGCAGGCACCAGAGCGTACAA
ACCAAGAAAACGTTGCAGCCGAAGAAGACTATGGGAAACCTGAAAAGGCTGTCGTTGAAATGGTGACACCCGCGGGGGCCGATAAGGCTAAAATGGCATC
GACCGTCAATGTTGATGCGATGAAGGTGGCAGAGTTACGGAAGGAGTTAAAGAAGCGAGGACTCGACACCAAGGGCCTCAAAACTGTACTCGTGCAGAGA
CTCAAGGCAGCGATACACGAAGAAAACGAGTCACAGTAATTTTCGTATTTATGCCAGCTGCACTCGATGTGATACAAACAAGGGATGCGTGCGATATTGG
TTTGGTCCATCTTAGGTGAACTGTGAATGCGATTGCATCGCAGTTTAGCGTGTGCCACTAATGAGAATTACAGATACTGTTGGTCTCTGGGTGGGTCAAT
AGTAGTTTGGCGCCCCTGGCGAGCATACGCAGAGATCGTGATGTCTTATCACAAGGAGTTGCGCAAGGTAGTCACCACCGTTCGGGCGTGCAGCAGAAGC
TATTAGATGGAATCGCCAGGAATAACGCAAGCGAGGTCAACTATAACACTAAGCGTTGCCGCCTTGCCTTGGAGTAGATGCAGGTTGAGAACACGAACAT
TTTCTGGGTCGACTTGCGGCAGATTCGACACAACTGTCGTCTCCTGGAATCACTTAGTGTCGTCATGGTATTAATACCATGTAGATCAACATAGTCGCAA
CTTCTAGGCAAAGATATCACGGTTTTCATCTGCCGCTCTTTTAATGCTTGCAATGAAACCTTACACTTACATTCCTGGGAGGACATTCAAGTGGACAGTG
TGTCCACTTCTaccatcaacttcatctcGGCTTTAAGTTACCTGACCAATTCAAGAAACATTCATACAACATTCATGCAACATCGATAAGCGTGAAACGT
GTCAGTCCAAGGCTCCAAGCAGATCCCGATACTTCGCCACGATGGAAATGGTGCGTGAAGTCCTCGCCAGTTACTTTCACTCCTACGTCTGTATACACTA
CACTCTAACCATCTTATCCTCACCACTCGGTATATGCAGGAAATTCCGTACACGAGCCCTGTCGACCCGGCGTCCTACGGGAACCTCTCTGTGATCTTCC
TCCTACTGGGTCTGCCTTTCAtgtcgctcttcttcacacGCGCTGTGGCccccaagaagaacgcgATGCTAGAGCTGGTACTGGCGCTTATTGCTGCTTT
ATTGCTGGGGTTCGGCACACTTTTCCTGTTCCTGTGGGCTGAGATCTACGTATAGACAGCGCTTTGCTACCAGTCTCAGTCTCAGCCCCCACGTGTATCG
GTTGAAGCTTAATCCTGATAGATGACAGACAGACGGCAGCATGACTGGGAGAtgcagaacagcagcagccagttTTGAATGGAGAAGAGCGTGCTTGGAG
TGAACAACCTGCCGGACCTGGAGCTAGCTGGAtagtgctgctgcaaaagaagACAAAAATATGTTTATTGTTTTTGCGCTGCTCGTTGCCGTGTCTCCTG
CGTCTGGGGTAGTATATGGCGGAGGCTTGGGAGGACGATGTAGTGTTCACTTGTCATTGCTTTTAGGCTTCGCCGTTCCTATGTTGGCCCTGCCCTGCCG
CTGGCTAGCTCGACTAGGCAAGCAGCTCTTTACCAAAAAAAATAGAAGTTGCTCTCTACCTCCTACAGAAGCGGAACGAACATCGCGCGCTGTATGCGCA
CGCCGCGTCCAACACTTGGATCATTCGCGTCTTCGCCCCGAGCTTCCTCCGTTTCTACTTGCTCTGCCTTCTACAGTGGATCGACCCTGTGAATCCATCC
ACACACCtaccagctcctgcagagACGACAGGGGCTAGTTGGCGCCAGGCATGAGACTATAATAAACGGTGGTCACGAACTTCTGCTTGTAACGGTTGGT
GATGCCAAGCACCATCATACCATCCTTGATAGCTGTGCAGTACAGGTGGTTGAGTGCCACATGCTGCGGTACTGGCAGCAGCCGGCCATCGACAGTCGGA
GGTGCCTGCAAAAGATCACACCACATGGCATAGATGCAAAAATACGCGAGTCAGGACCAGCGCAACTCGTCCAGGCACCACCGCATATATCTGTGACGAC
GTACCTTGTTTAAAATGATGTGGCGCAAATGAGGCGGGAGTGGAGGTGGCTCCTTCGTGTACTCGTCGATCTCGGGAATGTACCGGGAGTACGGGTTCTC
TggatcttcgtcgtcgtcctttCCATTATTCTTGCCATCAAAGTCGGACAGAGGCTCGAACTCTGATACGTCCACGTAGTTATTAACGTTCCCTTCCACG
TCGGCCATCGTGAGCTGGTCAGGCGCAAACCGCCAGTCATCGTCCACCACAAACTTGTACATGTGCTTCCCTCGCGTGAGGTTGGCAATGTACGTAAAGT
CATTTCCTGATCTGTGCATGGGACACTGTTTATCCCATCCATTAAAAGTGCCCGTGATGAAGACATTCCGTCCTCCATGCTCCCACTTGAACACCATGGG
GACGACATCTTCTCCTGGGGGTAACGGTACATTGCCCCCCTCTGCAACGGTGttccctgctgctgcatcatcttctttcACATCCAATTGCGTCGTTCCA
GTCATGTCTCCGTCCATATAAGACACGTCCGAGGATGATTCCGTGGGCGGGTCCACCTCCATAGCCTCCGTGGCGTTGTGATGGGCCGCGTAGTACTGAT
CCTGCGGGTGCTTACCGTCGCTCTGTCctggttgctgctgcgtctgccCCTGGGCCTGGTTATAGTATGGGTGGTGATGCAAAGGGAATGCATTGGGGTC
GTTCGGGTCGGCGCCCAAGTTCTTGGGGTTGGCGTCGCCCGCTttgctggaggcgctgccCATTGCTGCCCAAACGCTAACAAACTACTAATAACTGCTA
CCGGTCTCTGTTGTTCGCTGTCCCGTTGCGCCTTCCGGTGGGATTTCTCGAGAGTGCAGGGATGCTTAGGAATTGCACGGGGCGTCTGCCGGCGAGGAAT
GTGTCTGTGGTCTTGGACCGTCGGAGacttggcttcttcttggctcGGGCGCTTGGCTGGCTTCTCTCTATTACAAAGAGGCACATACAAATCCCGCTAA
CGGGTGCGTGAAGACCGAGCCACAACGGAGGCGCATCATTCGCGAAAAACCGTCGTGTTCCTGCGACATTCAAGGAACATACCTATAAACTACAGAACAC
ATTTTACTCAAACAACGTTCGCGTTACCTGCTGGGAGAGGTAATGGCTACATCTCAGATAGTTAAGAAGAATTAGCGTAACTTCATCAACGAGTATCGTT
GTACGGACAGGCGATGATGTAAGGCATTGACATTCATTCATTACATGTTTATAGAGAAAAGCAAGCTGAGGAATGACAAGCTATTTGATCGAGTCATTTG
AACACAGGTATTTACAAGAAATGGAGATATCGACAAGCGTGAGCTCGTGCCCGAACTCGACAAAAACCGAGACGGCGCGATTTCGTACATGGGATTATTA
GTGTCATTAGGCATCTCGGTTGAAGAAAACAAGTGAGAGATGGTCAAGGGCATTAGAGAAAACGTCCGAAAGGTTCGCAAGCGTCGAACTGCAAACGACA
TCAGCTTTAAGgaagtttttttttccttcATTTCGACACTGATCGAAGCTCAGTCCATCGAAGAATTCGCAAATGCTGTCCatcaagtgcttcagctggA
CACGAAGAGCGGAGAGGATG