Description :
From Genome Similarity Track
Location :
Scaffold_11:43606- 71810
Transcript NameFunction/comments
Phymu_g845hypothetical protein

Sequence
28204 bases(100 bases per row)
CTTCTGCACGTGCTCGTCCTGGCGGTCTGCGTATTGTCCCAGCCAGTGCTACCACAGGTCGTTTCGCGGTCAGGCTGCGCGTGCCAACCTCGAGTTATAT
CGGGCGTAAATACTGGCGTAATCTGCTATGAGGACACAGCCAGCTCAGGCTTCACGTGTGCGGTGAACCCGTTGGATCCCTGTGCTGACGGCGTCCTCGG
CCGAACATGGGATCTCTGTAATGGTACGTCGATTACCTGTATGTTACTTGCACGTGGGAAACACTAACATCGAACCTTCAGTCGTGAATTTGTATCTCGT
CAGCGACCGCAGCTCCTCTGCAGGCTCGGCGGGATCACTTGATGTAACTTTGTATGGAGAGAATCAAATTGAGCTGAAGACGGTAGAACTGTCGAGCGAC
GTTCTTGAAAAGAAGATTTCAAAGGTGACACTGCCGCTGGATAACGAAGCAGTGGTGAAAGCTGTAAAGGTGCGTGTTTTGGAGGAAAATGGAGGTGGAT
TTAAGCATCTCACTGGTACTTTTACTCGTCCAACAgattgaagctgcagcgaaaaCTTCGCTTCGGATTTTCGAAGTGCAGACTACGGTGAATGGAAATC
CTGCTACGGTCTTTGCTTCTCCAACCCCACGCTCCATTACCTTCGtgggcagcgacgacacgaGCTCTGGGGTTGTGTCGCTATGGTTTGTGCCTGTGAC
GGAGGCTCTAACTGGTCGGTGGCTTAGGAAGATGAATGGATAAAGGGGCGAGGGGTGACTAACGTCTTGCTGACTTTTAGGTACTGTTTTGAGTCAATGC
TTGTTTGATTTAGCTGGGCGTTGTGGATATCACGCCGACTTGGAGGAGAGCTCTGGCGTGCTTTTCCTAGCGGAAGACAGCAATGAGCCAATTCTATCAG
CAAAGTCAGCTGCTACACCTGCATTTCGACGCCTAACAGAAGTTGATACGCGCTCGAAATTCGAGCCACGGTCCCTGTCGTCGTTTCCTGCAGTAATTGG
GCGTCCTAGTTATCAACCGACTGCTTCATTCCATTTACAAGCTGGAACTGCGTTACCTAGTGACGAGAGGATAGTTGCTTCTACTTCAAACGAACCGGTG
GAGGTTCGACTCAAGGATGTTCTGGACGATGTGAAAGAAACTCTCGAAGGAATTGATAGCTTTGATCTCGTATCGGTGAAGGTTAGCTGGAGCACCGACA
GTGCTTTTAACTATGCTCGAATTGGTGGCGCTTCCTCTCGACTAGAAGCATTGAACGGCAGGTTTGTGACGATTTGGAGATTACGACGTCATGAAGCGGC
GATGAAGGTTTTTGTTTTACCAGATTTTACAGGAAGACACGACTTCATAGTCACAGTGGGCATCAAAACCGCAGGCAAAATGCAGCGATACTCCAAAATA
TTTTTCGTGACTATAGAAAAGGATTCACAGCCACAACCTTCAACCATTGGCGACGCAATGGAATCTCAATTagaagaggacgaagctTTTCAGGTCGGCA
TTGATACGAAAGAGGCTCGCAGGCTCGATAGTTTGGACACAGCACATTCTAACGTGAAAAGAGTGGAGTTGCAACCCCTCGTTGTCGATTTACAAGATAA
TGAGCCATTTCGCCTTGTGGCATTGGATCTTTTTCCAAACGAACCAGATACAAGCACTGCGTTCTGTGAGACGAccttcatgatcttctcTGTATCCAAC
GCCATTGAAATGCTGGCAACACCCTGGACAGGTGTCCACTATGTGACCAGCACTCATAACCCAGTTCTCACACATCTCTGCAATGAAACATTATCAGCTA
CGCTACTGGCAAATGTGAAACACATACAGGCTCAGATCCAAGTTGTAATGATGGGTACAGATGACACCGTACTAGCTATTGCCAGCATTCCTGTTACGTG
GTCTGTGATTTCCCGAGTCGACGTGTCATTTCCAAGCCAGATCCTCCTTGGCGCCCATAATATACTTGCTGGTGGAATATTGGAGCTGACACTGAATTAT
GCAGACTCTTTGGCAAAGTCCAGTGTAAACATCGTGGTCTCGAATTGCTCCTCTTTCGACATTGTAGCTGTGGGCTCTGCAAATCCAACAAGTGAGGAGT
GTACTTTCCTCCTGAAAGACACTGGCACGGTCGAGCCCGTTATCTTTAGTGGAATTAAAATCACTGAGCGCCAAGATCTCCCCGCGGTCGTTGACATCGA
TGTGATTACTTCTCAGTATGCGCAAGGTGAAGATGGCACCTCTTGGACTGTTATCTCATCTAGCGCTCTGTCGTCCACTGTATACTTTTGCGGATTAACA
CCGACGCCAGGAGGTCCACTACTCTTCCGTAAGGGTGACGTGAATACTGTGGATCTCTCTTCCATCGCGCTTACACTTCTTGGTTCCAACTTTCTTGATT
CCCAAATTTTGAAAAGTGTTTCTTTCGTTTTGGACTCCACGTTGGCGTCGAACATAggcaccttcttcgtcaacagTGCTCATGCGCAAGTGGAGTATTA
CAACGTTACCGCTTTTATCGTGAGCTTACACGCAGATACCGGCAAAGATTACTCGTTCCTACCATTGCAGTACGGATCTTTTCTCGTCGATGTGATCGTG
GCGTGGGAAGGCCTTAGCAATGACAGCactggctgcttcttcgtgccgAACATTGTGATCTCAGTGATACCTTCCTTTTCCCAGCCAGTGTTTGCTACTC
CGTATTCTTTCAATCGAAGAGTTGTTCAAGGATCATCAGCTCAAATTACAATCCcaacgatgacgacgacgaatcCAGACATCGAGTACGTTACGCTGGC
TGTAGCAGTGAACACGACCGATGGTGATGCAATCGTCATCAAACGAGATGGTGTTGAGTATTTTCCGTCGCCAAAGGACCAGCGCTACTTTCTGCTCGTT
CAGCGAGATGATGCCATGGACAGTGCTAGTCGTGTCGTACTCTCTGTCACTCCAAATGGGAATTTCACTGGAACGCTCCAGTTTGATGTGAGCGTATCTG
CTATTGGCATGGTAGACAATGCTGATCCTTTTGAAGAGTTGGGGGCCGAATTAACGACGATTCGTGGGGTAAATATCGAGTGGATTCCACGAGCAGATTC
AATGAGTGAGCCTACCGCTGCAGGAAAAGCAGTCTACCGAAGCTTGCCAACACAACTTCGAGGTGACTCCACGCTCTCGTTCAGGTATCAAATGTCGTCA
GGTACGCGACTTTATCCTTTTTCTTGCGTCCCCGGCGTTTCTAACGTTTGTGAACCCACCACAGGTTTTTCTAGTATTAGTACCGATGTTGTGCTGAACT
CCACCGAGATCCGACGGCTGTGGTCTAGTGACTCAGTCTCTCTTACTGAAAGCGCATGGAATTATGCTGAAGCGTTGATTAAACTGCCGTACGTTTCAAC
AGCCGAAATCGTGTTTCGTGGCGAAGTTtccgaagaagacgcactATACCTAAAAACTATCTCGATTCGAGACTACACCCAGGAGAGTATGGTTGGAGAG
ATCCAGTTTATTCGTGCCACAGGGGGTATGATCTACGTCGAAGTCGTCACAGCGAATTCCATTCCAGAACCTGTTCTTTATCGTGCTTATGCGAAGGAGG
TGCGCAACAATGAGGCACCAACCCTTCGCTTCACAGGTAAACTCCTAAGATTTACTTTATTATGGGTAGTGGGTGCCTAACTATTATTCTATTGCAGGCG
ATGCATTTCAGTATCTTGGTTGTAAATCTACCTCGTCAATGTATCAATGTGTCGGGAGTTCGGGGGTCTCATATCACGGTCCAAGTCAATGCCATTCTTT
GTGCTCGGCTACCGAAACGCAGCTTCAATTTACTTCCGAATCGATTGTGCGGAGTGAGCAGATGATAGCTGTTCCAATCAATGATGCTTTTACGATCGAG
TTCTGGGTGTACCTGGACAACTTGAGCTCGAGTTTCATTTACCAACAGCTCCTACTTCTCTACGGTTCACAAGAGGGGACCCTGAGTATCACGATAAACG
GCGAACTGGTCATTTCACGCTGTAGTAACCAGCTTCGTGTTCCACATGGCCTTCCAGTACACAAATGGACCCACATAGCCTTTGTGTTTAGCGCTGACAA
CGAGGTGGCAATCTTGATACAAGGAGTTAAGATGGCAACAGGTTTACTGAGCAAGTCAAATTGTCCGATACCGACTTATGCGTACCTACAACTTGGTCGA
GGTACGATATAAATCTCTCTCACCTTCATGTATTGTTATCTGACTTCGTTTAATGAGTAGATGCTTTGAACATTCTATCGGATTCTTCTGCGCTGCAAGG
TTCACTGGATGAGGTAAGATATTTTGATGCGAAACACAGTAAAAGGTAAAAGACTCACATGTGGGTGAGTTTTTCCTTAAATCTAGATTCGGGTGTGGAA
AGTGGCGCGCGATCCGGCGGAAATTTATGCCTCGTACCAGCAGAATGTTGCCGGACCTGATTtgattcttcttctccttttcaaTTCTGCTGAGTCTACA
AACTGGTTCCCATCAGGAGTAGATGGAAGCCCAAGCGGTGCGAAGTTTATGGTGCAAAATGTGAAAGCTACGAATACTCGGCCGATCCAAGAGCTTGGGA
TGAGTGGAGATGGACATTGCTACTACAGTTTGTTTACATCCGCTGTCAGCAGTACGTCAATTACCTGCAATAAACCATGTGAACTTCATGGAATTCTGAG
AACGTGTGGGTCGAATACTACACCGTCAGTCGCTAGCGTGTACAGACAAGGCTCTATTGGCATCGGCAGGCTTTCACCCCTAACGGATTACGAACTCTCG
ATTGAATTTGTGACTGAAAATGGCAAAGAATACGAAGTGACACAAACATCTATTGCACGCACGTCGAACGTGACAATCCCCGGGACAGTGGACTACATCG
GTGTGGTGGAACGCTCAGCCGAACTGCTAGAACTTCACTGGAGCCCTGTAGATGACGATGGAGGGTCCGACATTTTGCgatattttatttttttcgATGG
TATTAAAGTCGGAGAAAGTGGAAATCTTTCGACTACTTTCAACTTTACAGAGATGCAAAGCGGTTATACAGTCACCATTCAGGCAGAAAACGCGCAGGGT
GTTGGCAGTCAAAGCAATAGCCTTCGCTTAGATGCCTTGCACAGTGATCCTgctccacagcctccacaACAGCCTGCCGTAAATCATGTTTCTGGTGGAA
GCGTGGATCTCGTGTTGGACGAAAGCACGCGTTTGGCTGTTGAATATCGATCGTCTGTGGTAGTGATCGAGCAACGCGAAGCTCTTACGACATTCTTCGC
TCCTTCAGCATTTAAACTCAACGGAGCGTCAGCAACTGTTTGTAAGCTACGCCACAACACTGTTTACATTTTCCGTCTCAGTGTGATTAACGAAAATGGA
GTTCAAAGTGCGTTTAGTGCGCCGAAGTCGGTAAGAACCGGAAACAGAGGAAGTCCAAGCAAGACACCATTGCCTTTGATATTTGGTGTCACAGGTATGT
ACTCCTAGTGTTAGTTTGCTTGCTATCCTCCTCTCCGTctcacttcttctttttaaTTCTGCAGGGGGGTCAATCAAGCTGGTACTGAATGAACCTCTTG
ATTCAGGTAAGTGCTATGGTGTACCGCGATAGTACAAAAAGATGTTTATCTTTGTTTTTGATAGGCGGCCTCCCAATTGCTCAATTCAACCTGTTTATTC
TCTACGATGGCTCGTTCACAAAGCTGAAAAGTATACTGGTATCAAGTACAAGTGTAACAACAGCTTTGGTGACACACGACGCAGATGGAAGCCCTCTGCG
TTCTCAAACGTCGTACATGTTCAAagcgttggcgctgcaggccAATGTTGTGTGCGACACCCTGACTGCGGATGATTTAGCGAGTGACACCGTAACTGCA
ACGACAGGTGACGCTGCTATTCCCGCCCCACCGTCAGCCCCAGCTCTGCTATTACTATCCGGATGCACAGCGTTAGTGACTGTTTCGTCCCCAGACGATC
TCGGCGGTGCTGGTGTCACAGGCTTGACTATTGGAATGTTCTTGTCTACGGGAGTCTTGTATGAAAGCTTCGCAGTCCCGTTAAACCCTGGAGAAATTAC
GATTCGAAAACTGTTAGCCAACACGAGTTACTCTGTACGAGCTGCTTTCACGACCAGTATTGGTGATTCAGGATTTGGCGAAGCACTGAAATTTGCAACG
GCGAGTCCAAGTCCACCTGGGAATTTGAAGTCGTTGATAGTCGCTCATGCTAGTTCCAGTTGGGCGTATGTGCAATGGGAAGGACCGGAGGATACAGGAG
GGGGTGCCATCTCCGGTAACGTCTTATGACCATTTTTGTTTCATTGGTAGGATGGTAACATTTTTGCTGTGCTGTCTGTAGGGTATTTACTTTATCAGCG
CACCGCTCAGACGAGCATACCTCAAGAGCTCATTTACGATGGATCAAGTAATTCGACAACAACTTCGTATCTTGTTGAAAGGCTCCTGGCCAACACACTG
TATATCTTCTCTGTCGTTCCGATCAACCAGTATGGTCTGGCTGGCTTCAATCCTAACGTTATCGTCGCTACtacagcagctgctgaagtgCCGTCTCCTC
CAACTAGTGTGAAGCAGACTCTCGTCAGTGGTGGATACGTGGAGTTCAGTTTTGTCGAGCCGTTTTCTACTGGTGGATTTACACTCACGTCGCTCCAGTA
TTTAGCTCGCCTGGAAACGTTGTTTTCATGTTACAATGGCGCAACCAGTTGCTCTACGTGCACTCACGCTTTGGATGCTAGTGGTGCTATCGTGTCGGTT
GATGGCACCTCGTGTTCCTCGAGTAATAGTGCCGGTTGTTTCTTGAATGCTGGCACTGAGTGTGGAGTTCTACACACGGAAACGAGGGCCTGCACTTCGA
ACACCCCAGCTGGAACGTGCCGTGTAGAAGGCTTGACGTTTCACACAACGTATATCGCATCGATAGCTGCGGAGAACAGCGTAGGGAAAAGCCCCTTCTC
CAACAGCATTGCCGTCACCACCACTGAAACTACACAGCCAGGAGTACCTCGGCTTCTCCTTGTGTCTGCCACTGGAGGTTCAATAACGCTGCAATGGGAG
CTTTCAGCGGTAACGGTGAAGCCTTATGAATGCTGGTACACATTGTAACTAATCTTGTTTAATTTTATTATTTTGCGTTTAGGATACGGGAGGTGTATCA
ATCGTGCGAATGCATCTTAGCGTGGATGGAGCCGAGCTATTTAATACGGAATCGGCCTTGACCTACACTCATTGTGGAGGCCTTGTGGCGAACACGGATT
ATACGTACACTGTCGAGATTGAAAATGCGGCTGGGCTTGTAAATCGAGCGACTTCTACTTTTTCAACTGCGGCATTAACTCCTGTTGGACTAATGGCGAT
TTCAAAAACCTACGTGGGAATGAAAACAGCAAAATTTAGTGTCACGGTGCCGTGTGATGACGGAGGCGCAAATGGAGGCGTGTCCTTATCCTATCGTGTC
TTCCACGTTGGTGATGAAGCTACATTAACTAACGGATTGATTGGTTGCTGCTCAATCAGCATCACCGGACTGGAAGCTTCGAATGATTATCGTATTGAAG
TCCAAGGTGTGAGTTCTACACTTGCTGGGGAATGGTCAGCAATGAACTTCACCACTCTAACTGGGATTCCTTCAAGTCCCGATACGACAATGATGTTTGT
GACTGCAACGGCATTGAAACTAGCACTGATTCCTCCCTCCGTTGCAGGCGGCAGTCCACTGGCGATTGAGGTGATTGCTACAAGTGTTACTACTGCAACC
ACCGTCTTCCAGGACTCCTTGAGCTGTTCCATGGCCGACCAAGAGTTTGATTGTCCAGATACATTATCTATTGACAACATCGATACTACTGAAAATGGAT
ACACATATATCGTCTCTGTGAGGGCTGTTGGCGATGGAGGGTCGAGTGTTTGGGTAAACCAGTCGTACGATTTGGATGATGGAAAGCCTGGTAAAATTGG
CTTTGTTGATTCGACAATTCATGGTACTGAAGGAAAAAACATTGACGTGAAAGTCGCTCGGATATATGGGTCTGCTGACTCGGAGCAAGCAGATTTTACG
ATAAGTGCTGGAACCATAGCTCCAAAATGGAGTTGTGAATCCACGCCCAACGGAGCCACTTGTTCTATTAACGCGGGAGGTTATAACTCAGGTACACATC
TTTTTGTTATTGCGGGAGAATATGAAGTGCTTAATGTCTCTCTTGCCTTACAGGACACGTCGTTTTCGGGCCTGGGGAGTATTTGAAGACTGTCACAATC
TCAGCGTTTGATGACTCACAGtacgaagctgaagctgtgtcgctgaagctggttCTTGTGTCTACTACAAGCAGTGCGTTGAATAATGCGCAATGCAATG
TCACATTTGATGATAATGGAGACGCAGGAACTGTGGGCTTTGAAAAAGCTGCAATAAATGCGGTCGAGAATCAGGGGCTAGTAAGGATTGTTCTGATGCG
TACAGGGGGAGTAAGTGGCGTAGTGGCTGTAACGTTGACATCAACTGTCAGTTCGAGTATCAGTGGATATCAGCTGAACCAAGTGGTTTACTTTGCAGAT
GGAATTAGAACTGCCACGAGGGATATCGATATCCGCAATAGCGATGCGTATGAAATCAGGCGCTATACAGTTATGCTCTCCAACCCCACCAATGGAGCAA
CGACTAGTGGGAATCTTTCAGTGGTCATTCAAGATAAAGGAGATTTGAGTTTACCAGGTCTGCCACGCCCTTCAGCAGGATCGAGCACAGGTGGATGTAT
CACGTTGGTTTTAAATCCACCAAAGTTTCTCGGTGGAAATCCGGTGTCGATTACTTACTTTGTTACGGTGCTGCATTCGGCCACCAGCTTCTATAAAACA
AGTACCACCGAGGCGAATAGTATCGCCACGTGTGACCTCAAATCCAATACGACATACACGGCCAATGTTAGGACTAGCAATGGCTACGGATTAGGCGGCA
CTCGGACTCTCAATGTTTCAACTGGAGATCTTTCGGCCCCGACTGAAGTCGTTCAACTCCTCGCCGATACCGTTACTAGTGGGTATGCGAAACTGTCATG
GCTTCCCCCTCTTGATAAGGGCGGAATCGCGATTGCCACGTACAGCGTCAGGGTCTTGAACCTGCATTATAACGTGGCGCGAGACATTAAAGTGTCTGGA
TCATTGCTGTCTCTATCTGCGGGTTACTTAGAGGTTGGCACGTGGCATACATTTTTTATTCGTGGGGTGAACAGCGGTGGATTAGAAGGACCAGAAGTGA
GTCTCAACGTGTTGACTGGGAACGAAGCAGTGGCACCACAGCAACCACCTCCGCCGGAATTGATATTCGCTACTGGTGGGGCATTAAACGTGAGCGTGCT
CGCCCCACTTGACTGTGGGGGGTTACCTTTGACTTCATATGTTCTCAGTATAGCTCGACGCATTGGAGGAACGTTGGAATACCGCCACTACGCACAAAAC
AGCGTCCCGAGCTCGACTTACGGGGACCAAATTGTCGCGAACGTCTCCATTTACGGCCTGCTTTCGAATTCGGAGTACTTTATTATTGTGGCTGTAGAAA
ACGCTAAGGTACCGAGCCCCACTGctttcatttttttttatgtGTATTAACGATTTATCACTGTTGCTACTAGGGATGGAGCAGTCCAAGCGATGAGAAA
GCCTTCTTTACCACTGACCCGACACCAGTTGGCTCGATTTCCCCTCCGGTGGTTGTACTGCAGGATCCTGGGGAGTTAACACTAAATTGGAGCGCTCCTT
TGGACTCAGGTGGCCTTGGCGTTGTTGGGTACAAGGTGCAGTCACGTCGCCAATTCCCAAATGGCTCCTGGTCACTTACCGAGGTTGTGTACGAAAACCG
GAAATCGCTGGTGCAAACAGCGTTGATCCCGAACATTTTAGCCAATACACAGTACGCGTTCAGCGTCTCGGGGTACAATTTCCGAACCTTGTGTCGTCCG
GATGAAGATGTGACGCCGAGTGACGAACTTCTCATCAAGACGCAAGACGCGTCTGTTCCATCGCAGCCGAAAAACGTTCGCATGATTGAAGTGACTGGCG
GATCAGTTACTTTAGCGTGGGATCCTCCGCGCTCTTCAGGAGGGGAACCTTTACTATGGTATCTAGTCAATGGAGGCGCCGAAGGCAGCCCGCTGCAAGT
CATGGCGAATGTTAGCGCTTCTGCCCCAACGTCACTCACTTTGTACGGCTTCACGGCTTCTTTTCATTATGAATTTGCGGTAGCTGGAGAAAATTCTCGG
GGCTCTGGATTCTATTCGCCATCTGTGTATGTAACTACAAGCGGTACAAGTGCCCCAGGAGCTCCGAAACAATTGCGTCAAATCTCGGTTTCTTCCGGTG
GAACGATTTTACTTGCGTGGGAGCCTCCTGATGACTCGGGTGGTGCAAGCGTTACGCAGTATAAAGTGACCCGTGATAACAATTTCGTTGGCAATGTGCT
AGCTGCTCAAGGAACCACGAAGTTTCAAGACCAAGGCAACATTCTGGCTGACAGGAGCTATATCTATTCAGTATTTGCGTCGAATGATGTGGTATCCGGC
TCAGGAGCAGCTACCCTCATGGCTCatagtgctgctggatctgttcCTGCCGCTCCTTCGGCTGCGGCTGAACCAGGTAGTGGGTTTATTGGACTAAGTC
TTTTTGCTTCACCAGATACTGGCGGTCTTCCTCGCCTTCGTTTCGAGTTGACAATACTTCGGGGAACGTCGACGATCGACGCCTACGACACGACCGAGAC
AACGTTCACAGTAACTGGGTTGTACGCAGAAACGGAATACTCCATTATCATCCGGTCGGTCAATACTGCTGGGAAAAGTGAAAGTTATACACTGAAAGCC
AATACGTCCGACGCTACAGTTCCCGACAAAGTCAACATCCCAAGATTAGTGGAAGTAGCCGGAGGTCACTTAACATTTGGAGTTGTCGCACCGGCTAACT
TTGGCGGGAAAGAGATCACGGACTATAACTTTTACGTGAACGGAACGCTTGGTGTGGTGAAAAAGCGGTCGAACAACGAGTATGATCTTGTTGGCCTCAC
GGCACTCACGTTTTACGCAGTCACTGTATCAGCGACAAACCGCCAGGGGGAAAGTCTTCAGAGTGATCCGATCGTTGTTTCTACTGAAAAGGTTACCGCA
CCTGGTGTGGTGCAGAACCTCTCGACAGCTTCTGTTACGCACGATTCAATTATTCTCGTATGGAAAATGCCATTCGATACAGGCGGAGATGCAACCTCTA
TTTCGTATGATATTAACGTGACCACAGCTGACGGAACAACTCAGACTACATGTGATACTGAGACACTGACGCAAAGCGACCTTGATCCGGCAACGGTTTA
TACTTTTCAAGTTAGCGCAGTGAACGCTGCAGGCAGTGGCTTGTGGTCTCCAAGCTTATCGGTGAAGACGAATCCTGTTTCTCCTGGAATTATTAATTTT
GCCAGCAGTGAGGTGGAAGTCTCTGAAAATGAAACGTCGGCAACCCTTACACTGCTTCGTACTCAAGGGGGATTCATAGCGGCCAAGTGTTTATATTCTA
CAAGTGACGGAACTGCGCTTGCCGGGGTCCAGTACGTGCAAAGCAGTGGTGAAATCGACTTCGAACGGACTTCGACCTCAGAGTCGATACAAGTTACCAT
CCTTAACAATGAGGTGGCGGACGATCTAGACAAATTCTTTTTTGTTACGATCCAGGAATTTAACAGTGATTCTGGTGAAATTGGAGAAGTTGCTAAAACG
AAAATTACGATTACGgatgatggagatgcagGTTTCCTTGCATTCGGACAAAATTACTATTCTGTTTCGGAATCGGTGTCTGCGCTATCTGTGAATCTCG
TGAGGACGGTGAAGTTCAGTGGCAATAGTGTGGTCGAAGTTGACGTGGTTGATGTCCCTGACGGCGCCGTTGAAGATGTAGATTACGTCATTTCAAACAA
GACCATTGAGATTGCTGATCAGAAAAAGCAAGGATCAATCAGTATTTCGATTATAAATGATTTAACGTATCAAGTCCAAAAGATattcaagttgaagctc
cGAGTTGTTAGTGGACGAATTGCTGTCGATGGTTCGAACGTGGTCGCTACAGTTGAGATTCTAGATGACGGAGATGTATCGCCCCCGGGTTTGGTCACAG
CGATTGAAGCTCTTGTCATTTCCGGGGGAGTTGTCAACGTTTCATGGGTGGCCCCGGGTTATTTGGGCGCGAAAGCTGGTGTGTCGTTGTCATATACTGT
GCGTGTGATGGAAGTTCAGACGGGTTCGACCCAAGAGCTACCAACTAGAATGGTCAATATTGTCATTCCACAGCTACAAGCACGAGCAGGTTATACGGTT
TCTGTTGTGGCACATAATGGGTACTTATTAGGAAACTACGCTACCCCTGTGGCCGTTTTAATGGGAGCTCCAACCCCTCCATCGAAACCTCTGGATGTAC
AAGTTCTGGCAGTAACCGGCGGAATGGCAACTTTGTTGTGGACGTCTCCGTTTGATTCAGGAGGTTCCTTCATTGGAAGTTACCGCGCAAATGTTTCGGC
TAGCGATGGAGTTTTTGTGGGCTCTTACACTTCAAGTGGCAATACCGTATCGACAAACAACTTCAGTCCGTTGACAAGTTACAGTGCAACTGTCGAAGCT
ATCAGCATAGCCGAACAAGTTGGAGCAGTCAGCACCGCAGTCTCTTTTACGACGACGTCCGCTTCAATTCCGGGAAAACCCACGTCATTGAAATCATCAA
ATGAGACAGGAGGAGTGTTTCTGGTTGATATGGCACCACCTTTGGATATCGGAGGCATTCCAATCTTGAACTATACGCTGCTAATGACATCGGCCCAATA
CCCAAATGTCTTTCGCCAAGTTTATCAAGGCCCCGCCTCCTCATTTCTCGCTACGAAATTAACGTTTTCTACAACGTACAAGCTGCAGTACAAGGTGACT
AACAGCGCGGTAAGTTTTTATTCGTTTATTTACTGCACGTAATGCCCATAGAAATCTGACTACTTCTTGCTTTTAGGGTACGAGCGAGTTAAGCGATGCA
TTCACTGCGACCACGAAGTATTTATCTCCACCAGGACAAGCTCAAAACCTTGTACCACGTTCACGTACCGGAGGTTCTGTTACCTTTTCTTGGACACCCC
CTGCGGACTTTGGCGGCGTTGACGTTACGGCGTACGACATTTCATTCTTCCTTGGCTACGAAGTCAAGGCTCAGTATCGTCAAAGGGTATCGGGAATTAG
TCCGCAAGCAACCTCAGTCACTGCGAAAGTCGTGGGGTTGGTAGCTAATTCCACGTACGGATTTTCCGTCTCTGGTGTCAATGACGCGACGGTATGCGAG
GATCCTTCAGCACTTCTCACTCGCACAATCGTTTACGATAGCACGGATCCATTAGTTTCGGTACCGGACACTCCGACGAGTTTGGCCGTTGTTTCAAGTA
CATCAGGCATGCAAACAATTAAATGGGCGGCAAGTGAAGACACCGGAGGTGGCTTGCTCCTATCGTACGTGCTGTACTCAAGCACAGGCGATCTTTTGTA
CAATGACACGAGTACTACGTATACGCGTGGGTCTCTGATAAAGGACACGACGTACGGCTACAAAGTGGCAGCTTGGAATGAAATGGGGACAAGTACACAA
AGCTCACTGGTATCTGCTACTACGAAAGCAGGCATTGTTGCACCTAGTCAACCGCGCGAGCTTACAAAAGCGAAATCGACTGGAGGATCCATTAGTTTAA
CGTGGAAAGTACCCTTGGACAGTGGTGGAGATACCGTTTCAGGGTACAAACTTCAGCGTAATGGTACTTGGAGAGCGGACATACCAGCGGATGGGGCAAC
GATGATGTACCTGGATGACCAGGGACTTGTTGCATCAACCCAGTACGTTTATGTTGTTCAAGCAAGCAACTCAATTGGACCAGGCGCTGTGAGTCAAACC
TTACTAGCTTCTACAACTGATGCTACTGTTTCAAGCCCCCCAACTCGACTAGACGTCGTTGCGAGGGGAGGAAATTTGACTGCAACTTGGgttgctgctt
caaataCTGGTGGGATCGATTTGACGTCTTTTCACCTTACTGTCAAGGTGGATACGTTGAGCAGTGGGTTTAGTACGACTACAAACACGTCTCAATTAAC
CTACACTCTGTTCGGTTTGAGAGCGAAGAGTTCATACACGGTGAGCGTGACTTCAAAGAATGCGATGGGGGAGAGTTCACCAACGACCCAAATTGTGGTA
AATGGGGCTGCTGTctctcctgcagctccaccagtcCCTGAACGCATTACAGATAATACTGGACTGCAAGCTTGGATGATCATGCTCAAGTTGTATCTCC
CTGTGGATGACGGGGGAGCTCCGATATCGAAGTTGAATCTTTATCAGAATGGAGAGAATAAAAGCTCCTACTTGATTGAATCTTCAAATAACCAAGCAGA
GCTAGGAGACCCTACAACTCGCTCGATGCTGGTCCAAGTCGGCCCTCTACATGCAGCTCGGCCTTATTTTTTTGCGGTATCTGCTCTCTCTTCTGAAGAG
GCAGTCGGGGAAGGAGCTCGCAGTGATGCACTGAAAGTACTGACAAGTCCAGCCACGCTTCCTTCAACCCCTACAAATGTTGGCGTTTCGCTTCGGACGT
CGTTCTCGATATTCCTGCTGTGGGATGCTTCTAGCGATACcggtggagatgaagtcgtgtATGAGATTGCTTATACCAACACCAACACGACACAAAGTGG
GCAAACAGAGACCAGTAAAACGACAATTGAGGTGCCCAAACTCAGTCCAGGCGATGTTTATTCGTTCCGAGTGCGTGCTCGAAACTCGGCTGGAGTTAGT
GAATGGACTTCCGACATTTTCGCTGAAACGGACGTGACCCAGCGTGGTGCTATTGTTTTCAATGTGGAGGCGTTGACAGTGTATGAGAATGTGAGCTCCG
TGACGGTCCAACTGCTTCGTGTGAACGGATCTTCGAGCACAATTACAGGCACTTATACGGACGGTCCTGGCACAGCCACAGAGGGTCAAGACTACACTCT
GCCTCTTGAATCAGCTCGATCGTTTACGTTTGTTGGGGAAATAACCGTCCAAAGCTTCGAAGTGACAATTATTAACGACGAGATATACCAACCGAGCGAA
CGGACGATAAACCTGACTCTGACGGATACAACCCCTGGCCGTAGCGACCCGTTTCCCTCAACATCGCTGATTATTAAAATACGCGATGATGGTGATGCTG
GGACGATCGGATTTGTGGAAAATGAAGTTGCTATCGCTGAAAACGCGCGCATTCTacctctgcagcttcaacggctcAAAGGGAAAAGCTCAGCAGTTAG
TGCTCGGATCATTCTTTTCACTGGTCTCGACAGCACAACGCAGCCCGAAGTAGGATTTCGCCTACCGTCGACCACTGTGGACTTTATCGATGGCCAAACG
TCCTCGTCCGCAAGTATCGTGATTAAAGACAACGACGTCTACGATTTCCCGTACCTGTACTTCTACCTCACTCTCCAAATTTTCTCTGGAGGAGCAACTG
TGGGGGCAAACAGTGTGCTGAAAGTTGTGGTACAggacgatggagatcgaTCCGTACCAGGGGTAATGAGTCCCCCAACGCTGGATAAAGCAACAGGGGG
AATGCTGAGATTAAATTGGAACTCACCAGTTAACGTTGGCGGACAGAGTCTGTGGATCAGTGGATACAGTATTTCTATTCGCGTTGTCAACTCAACAAAC
ACCATAGCCACATCAGATAACACCACAACGTTCCCGTTTGGCGGGTTAAAGGTGCTCACCACATACACTTTCACTATCGCGGCTGTCAACGCAGTTGGGC
GTGGAATTGACTCTCCTAGCGTCTCATTTGCTACGACGAATATTACCGCACCAGGCCCAACGAGACAGATTACTTTGGCAAATCAAACTGGTGGATTACT
TACCGTAAATGTGGCCTCACCAATTGACACGGGAGGGGCTCCAGTCGTTGGATACAAAGTTTATCTTGCCGGGGAAAGCGGGGATTTTAAGGTATGGATA
CTTGATACTGCTGTGGCTGAGAGTTCTTTTAATTTATGCCTTGTCGTATTTGTGTGTGTGAAGCTCGCATACGACGGGACGGGTCAACCTTTGTCAGTGA
TACCTGTGAGCGTTAGCAAGCCAAACACGGTTTACCGTTTACAAGCGCAGGTTTGTCTCGAATTGAAATTGTTTATCATATCTTCGACATTGACGTGCGT
TTATATGTGTATAGGCAGTCAACTCTGTTGGCGGTGGGGATGTCTCCGAGTCGTTTAGCTTTGTTAGCGGACCTTTGTCAAGGCCTGGACCGCCCAGACT
GCCTTCTACGTATTCATCTCGAACGGGAGGATCAAtatctcttcttcttcgacctCCACTTGATGCAGGTACGATCCGTACCAACACTTAAATTAATTAC
GCACATATAAATGCCGTATATGGACAGGTGGCCACGAAAAGATCTCATACATGATTTACTACCGCGAGCAAGGTCTCAGGACGCGTTTTCGGCAGGCTTA
CAGCTACGCAGAGGATACAAATATTACGATCTTCCGATTGGCCGCGGAAACTACTTACGAGATGGTGGGCGTGTCGCTTCTAGACAACGATACAAACGCC
CTCACTTGGGGGAATATTTCCGTTTCCGACTCTGTCGTTGCACTAAACAAAAGTGTGGCTACTGACCTTGTGAAGAGCGGCTATTTCGACTTCGGTGTAA
GTTTCTGCTGATTTCTCTACTCTCAAGATTTCACTAACTAAAGTATTTGCTTTTAAACTTAGGGATACCTTTTCGAAGTCGACTTATCTGCAGCTGTAAC
CAACAACATGATCGACTACTCGCCTTCCTTGAGTACGGACGGCGGAGCAATCGTCAGCACTAACCTCCAAAATTGGGATACCTATGACGTATTTGTTCGC
GGTGCTTTCAGTACAATGGCGACCTTCAACACTGATTCCCCTACCAAACCAGGAATGCCTCCTGAATCTACACTAAACTATGGCACAGGCGGTGCGCTCC
ATATACGCATTTCCTGGCCAAACGATACTGGTGAGTAAACTTGAGTTTGCTATAGGTTGTTCCTAACTCTTTTGCTCTTGATGGTACTATCAGGTGGGAT
CCCAATTACGGGATATACATTTTTTATCGACAACAAAACGGTAATTAGTTTGTTACCAATATGCTGACTCACTCTGTACTCAATCTAATTCTTCTTGGAT
ACACAGGTTGATGGGTATCTATACGAGTATAACTCACAAAGTCAATTGGACCTTCAAGTTACTGTGGAAATTGGCGGGTTGAGTCCCGAAACAACTTACA
GCTTTTACTACATCCCGTTGAACGATGCATCGGCGTGTCCAGGAGGCGATGAGAAGCTGCCACTACAGTTTCGATTTTCGACTGGGGTGGCATCTGTACC
GACGAGAATCCAGTTGATACGATCTAAAGCTGCTACTGGCGGTGGAATTCACGTCGACATCAAGCCGCCGATCGACAGAGGAAGTGACCAAGCCCTGTAC
TACCAAGTTTATATGAGCCCAAGTCGAGGGACTCCCATTTGGGGGCTGGTGTATAACAACACCCGCACATCCTATTGGCAaacgaagctcgagaaggaCA
CTGACTATATGTTCATAGCTTCGTGCATGAATGAGGTGGGCTCTGTTCAAAATTCGTCATCTTTCACGCTTCGAACCACCCTCATCTCGCCACCAGGTCC
ACCGAGTAATTTAAGCTTTATAAACGCCACAGGGGGGTTGGTCCAGTTCTCGTGGAATAGCCCCGACGATGATGGTGGAAGTCCAATTACCTACTATCAG
GTGAGGGCCGTCGATATAAGTGGAGAGCGGGAGCTTGTACAAGAAACCACGTTGACAAACATCAGCTTTGGAGGACTTCTAGCAGACAAGAATTATGAGT
TTAAAGTGTTCGCTGCTAACAGTTTGGGAGTTGGATCGGATGCTGGGGTGGGACAGTTTCCAactactgcagcaactcTACCGTCGCTTCCCGGTGCACC
AATTGTCCAGAAAACGTCTGGAGGTTCAGCTACACTGGCAATCCAAGTACCACAAGATACGGGAGGCATCAACATTGCGAAACTCTTGTGGAATGTGTAC
GCTAATGGTGTAAAACTCCCTGAAGATGCTGTGCGTAAATCAGTGGCGGCAACTGCTTTAACGGGCGGTTCTCGTCGTTTGGAGTCAAGGCGATTAGCCG
CAGATGATGGATCGATGGTCTACCTTCAAGCTGGAGGGTTACTCCCATCTACTACTTACTCCTTTACAGTTCAAGCTTTGAATACTGTCGGTGGAAGTGA
CACCACTCATGGTACTACTAACTCGACCTCTGTGGCTACGGTTCCAGGACCCCCAGAGCCACCAAAGTCAGTCGTAATCACCGGTGGAGCGATTGAAGTG
TCGTGGTCCGATCCAGTAGATACGGGCGGAGTGCCATTGACTGCATACCGACTCAGTATGACACATTTGGGACAGGAAATGGGATTCTGCGAGGGTATGA
TCCTTTCGTGCACTATTGGGAATTTATTATCGATTACGGATTATCAGGTAACGCTCTTCGCAAACAACACCATCGGTATGTCTCCCCCCAGTGCTGTCAC
TACCTTTACGACATCAAATACTTCTCTCCCTCGGGCCCCACAAGACGTTCACGTTGCTGAGATCGAAAACGTTTACGTCTCTATCCACTGGTCCCCATGC
ATCGACTTTGGTGGGGGCTACGTTCAAACCTACCAAGTTGACGTCGTACAAACGTCAGATACCAGTATTACGTTCACCACAATTGTGCCCTTAGTAGTGG
AGAACTCCACGATTACTGGGTTGACCCCCGAGACGGCTTACACGGCAATGGTGGTAAGTTTTATTGTGGTAACTACTGAGCACGGGAAAACAAATCATTT
ATTGTTTACACGCTATTGTACAGCGAGCGGTGACTGGAGATGCTCAACTTGGAGAGCCAAGCAATATTGTATTTTTCACAACCCCACGATATGCCAATCA
GCCTCGTCCCCCAGCAGTTGGGTGTCGTAAGTACATTTTCAAAAGTTGATGTGTACACTTCTAATCCAAATTTGTCCTGACTTCTTTTGTAGATTCACGA
AAAGTGGCTATTGTCTTTTGGGAAGTTGACGACGATGCCCTTAGCTATTTGCTGTATCGGGATGGCGCGCTTTATCGGGATAACGGACTCGATATCACGT
ACGAAGATGAAATTGTTCTAGGTCAGACATACACCTACCAGCTTGAATTATTACACCCTGGCGGTATACGAAGTTCACTAAGTGAAGCCACAACATTTGT
CGCGACTACCCCTACCACAACCGGTTTCGATTGCGTCGGCAATAGAGGACATATCCACTGGCATGATTACCAAAATTTGGACCACGAGATGTGGACCATC
GTACCCCCGACTCAATCCGGCTTGTTACTCAGCGTAAGTTGCCTACATACTATACTGTATGCTAAGCTACCGGTGAGAAAACTAACCGTTTTCTGGTGCT
TAATTCTACCTAGTTCTCGATGTTTTGGCTCGAATGTGATCACGACAGTTTAACGATTGACGTGACTACGAATGGTGTGATGAAGAACCTCTGGAAGGGA
GGTTGTTATCGTAACGGAAGTTTCGCTGTGACCACTGCAGCTGGGATCGAAAAGGTAACTCTTACATTCAATTCGGATAAGAGTATCACGTACGAAGGGA
TGGCGTTGCATTACGAAGCCGTCGATCCAAACGATGCGGTGGAATCGGTGTACGCCCCCTGCCCCCTCTCGTCCAACGGGTATTGTTCATTGAATGGCGC
ATGTCGAAAGGGTTATTGCTCATGTTTCACCGGCTACGTAGGGGAGAGCTGCACCAACGTCGTTATCTGTCCCGAAGACCTGTCAACGTGCACCCAGACA
TCGTGTGATCCAGTTTGTCTGCAGTCTGATACTAGCGTTATTGTGGTAAGTGGGAATGGAAATGATACCCAGGGAACGGGAGAGCGTATGAACACGTCCC
CCAGTGGAACAGATCCCAAAGCCGTGAGATCACTTCGACGGGCTTTAGAGCTTGCGGCATCCCATCAGACGATTTTGCTCTATCCTGGCACCTACACTGG
CGCTGATAATTGCGGTCTATCTGTATCGATTAGCACGCTAATTATTCGAGGGTTGCGAGGTCAAATTGTGACGACGATAGATTGCGAACGGGTCCACGGG
GGTTTAACCATTTCGAGCGGCCCAGTTCGATTGGTTGGATTAACGATACAAAATGCTGTAACATCTACGAATGGAGCTGGAATTAGTGTATCAAACTCAG
AGTTCACATTGGAAAGCAGCACCATCCGCAACGCCAACGCAGGTCAAAACGGAGGAGCGATTTACGCGATTCAAGCACAACTGAAGCTGATTAATACCGA
ACTCTCGAACAACTTTGCGATTATGAATGGAGGCGCTGTTTTTCTGGATGGGTCGAGCTTGAGTTTAGACCATACAGTCATCAAGTTGTCTTTGGCGCGT
GAGGGAGGTGGAATATACGCGCAAAACGTCGTAACTATGAACGGAGATAGCGACAGCAAGATCCGAGATAACTCTGCTACAGTGAACGGGGGTGGACTCT
GTGTAGCGGGGACTTTCACCGGCCACACCCTGACCATTTCACATAACACTGCGGTGGTAGGAGCTGGTATATCGATTACCAGTGGAAGTTCAACTTTTGA
ATTCGTGAATATTCTCGATAATCACGGACTAAAAGATGGAGGAGGTATTGCACTCCTTAGTACGGCGGGTCTGGTGCTTAAAAACTCGCCAATCCGTGCG
AACTCTGCCGTTCGTTATGGCGGTGGAGTTTTCATGGGGTCCAATGGCACTTTTGAGAATAACCTCGCATCTGAAATTTCCAGTTGTACGGCGGGTAAGT
GGCAAAGAAAACTTGATGTTGTTTTTTATATTACTGACGAAAATGTTTGTGGGTTTTGCCTAACAATTAGCTTCTGGTGGTGGGTTTTATGCTGCGGACT
GGACAAGCCCAACCGTTAACAACCTCATTGTACATTCTTCATCAGCTACGACATCGGGTGGCTGCGTTTCATTTTCTCACAGCACGGCAATTTTAAATAA
CGCAAAACTAGACCAATGTGATGCGCCTGCAGGGGGTGGCTTGTATGCTGGTGCTGAGAGCAAAGTATCGTTGCTCTACGCGATGATTAAAGACTCTAGA
GCAACAAGTGGAGCCGCCATGTACGTCAACTCGAGCTCGGTGGTTGGGGCAAGTGATACACCTTCGAAGATCGAAAATTGTAAAgctacagctgcagcgg
GGGGAGTATTTATCGCTGGAACTCAAAGCTTGTTACAGTATTTTAACGTGGAGAGTTGCTTGGCACCccttggagctggagtttTCATGCAAAATGCACA
AACTGCGACGATAGAGTCTGTAAACATCCTCACGAATACGGCAGCCAGACACGGAGGGGGATTATATGCTGAATCCTCTACAATTTCGTTGGGGAGTGTA
GTTGTAAAATCCAATAACGCGGTAGTAGGGGGAGGAGTGTACGCGATCGACTCGAGTTTATCGGGTACCATTACATTACGCGAGAATAGTGGTAATCTTG
GAGGTGGAGTTGCTACGTCTGGTACGACACAGTTGGAAGGAGCTATTATCGAATCGAATACCGCCACGCAGAGAGGAGGTGGGCTAGCCGTCGATTCAGG
AGTACTATCGCTGAAGGCCACCACAATCCAACTGTGTGTCGCTCCTTCCGGCGTCGGTGGAGGTATTTCAGTCTCGAACGCTACTTTAAAACACTTTGCA
GTAGCTGTTAAGCTCTGCAAGGCCTTGCGTGGTGGAGGGATGTACGTAGATTCATCGGAAGTTTATCAATCCCCCAGCCAGGAGAGCAACGGGGTGAGCC
GAAATGCTGCGATTCTTACTCAAAACGATGCGGTTGAATATGGAGGCAGCGTGTTCGTTGATGGGGAAGGAGCGCTCGTGAGCGATATTGTCGTTACCAA
AAGTACTGCACCTTCTGGTGCTGGCTTAGCCGTGCTGAATGCTCTCGCTTGTGTCATTCTGAACGCAGATATCTCGCTCTCGACTGCTACAGTTTCAGGA
GGCGGTGTATACTTCGGATCGGGCTCAAATTGTGTGCTTCGGAACTCGTTGATTTCTAAAAATCGAGGTGGTCAATCTGGAGGTGGGGGGATGATTGATC
AGGCTACAGTATATCACTCCAACGTGGAAATCTTCAACAACATGGCTCCTATGGCTGCAGGAGTTCAATTGACTAGTGAAACGCTACCGGTGAGTTTGTT
ATCGTGGGATGACGTCGCAACCAAAAGGTCACGTATCGACGCGAATGTTATCGACCCAATAACGTTAGACGGCAATGGAGCCAATGTCGGCTTCTCGTGT
TCGTTAAACTGTACTCTTTCGGGGGTTGTCGTTTCTGGCGCCAACTTGCCAACAGGACAAGGCGGTGGCGTATTCATTTCCGGTCTTGGCAACACGACCA
TTTCAGACTCCCTTATTGCGAATAACTACGCTGCACAAGGTGGGGGAATTGCAGCTAAAGACGCAAACACAACTCTTCTCCACAACGTGGCTGTAGTCGG
AAATGGCGCAAGGGATAACGGAGGAGGTTTGTGTGCAACCGGTGCTGAAGTTTATCTTATGAGTTGTGTATTTTACAACAATTCAGCACAACTGACAGGC
GGGGCGATCGCGGTGTACGGAGTATACATGGAGAGTTCTCAGTTGATGGTGGTGGAGAACCACGCTGGGGATAATGACAGGGGTATGGGTGGCGGCCTTT
ACGTGGATAAACGTCTCAGTCCAGATACGACATCTGGCGTGAGCGCTGATACGTGGTTGTTCTTGTCAAACGACGCTCTTGTCGGAGGatccattgctgc
agttaAAGGCTCCGAAATAAGTGTTTTGGACTCAAATATCACTCGAGATGCGGAAAAATTCTTAACAAAGACCTGGCAGGACCTTTTTGAGGACCTTGTC
GGCCTCAAATACGCCGCAGGACGAGCCCAAAACCGAGTGGACGTGCAAAAGGGAGATCTTGTGTATCTCTCGGATTTAAATACGATATTCGAGCTGATTT
CTTCATTCGCAAGCAACGGCTCAGCCGACGCAGGAGGAGGCTTTTATGTTAACGCCAATGCGTTTTTCTATTGTGAAGACTCGGAACTGAGCTCTAACAC
GGCTAAcgagcgaggaggaagcgtGTGCTTATCCAACGGTGCGTTAGCCCAGTTCGAATCCGTCACAGTACGACTTAGTGGTAAGAAACGAGCTTTTATC
GATGTCGTTGTGGTTGTCTCCTTAGCTaacttgtttttttttaacgTCCTCAGTTTCCAAGACTTCCGGGGGCGGGATCTTCCTTGACACGTCCTCGATA
TTCCATGCACAGAAGCTGCTACTCTCTGAAAACTTTGCCGATGACTCGGGAGGAGGAATTTACATGGACACAGGCAATAAAATCGCTGTCCAGCTGAATG
ATTCCATGATAGCACGCAACATCGCTCACGGCCAAGGATGCGGTACGAACTGACAGCTACGTTTTATGTCAAAACGCGTTCGCTAAACGAGATTTTCTTG
TGATTGACACAGGCATCTTCGtaggccaagaagctgtttTGGTGAGCTACAAATCCAGATTCATCGGCAACGGTGGTGTCACTTCCAGTGGGAAAAATGA
AGGCGGAGGAGCGATTTCCTCCGTCGACGGCGTGTTGAAGCTCACTGAGTGTTCGCTTATCAACAACACTGCGGTGGTTGGAGGTGCCATTAACGTCGAT
CGCAGCGGTTCGGCGACGATCATGGGCTCGAATTTCACAGGAAATACTGCAGATCAAAACGGCGGCGCAATCACGTTGAATGCCGAGTCGAAGGCCACGA
TAACGCAGCAAACCCGGTTTACGCTTAACGTTGCGAGCGCAGGTGGCGCCATCGCTGCAACTGGCGCTTCTTTACTAAAACTCACACTCGTAGTCTTCCA
AGAGAACCAAGCCCATGAGAATGGCGGGGCTCTCTATTTGACGGATGAAGCTACTATCGCATTGAAAAGAGGCGACttgagcaacaacagcgcGAGGTTG
GGAGGGGCCCTCCATTCAGACGAAATGGCGACGGTCAGGATCTACACCTCCAAGTTTATCACCAATGCGGCGTACATGCGTGGTGGAGCGCTGTACTATG
AGTCGATTGCGAATACTACCACGTCGGGGATTACGTGCAAAGGCAACACGGCTCCAAGTGGCGGGTGCATCTTCTGGATATCGACGGATGAAAATCTCAC
GTCTATCAACCCGTGTACGTCGTGTTTGATGGCGTCCAACGAAGTGTACGACATCGCGACCAACACGAGAGACGTCCACGTGATGTGGTGGCCTGAAAAC
ATCACCAGTGGCGTGAAAATCCTCGAGTCACCCGACGAAGAGTCCATTGTCGCTCTCCCAGCACGGAATTTTACTCTCGAGTCGACGAAAAACATTTGGC
CTCGCCTGAAAGCTGTTGATCTCTAcggccaagttgaagttttggATAATCAAACGGAGTGTTTCATGACGAACGCTATGTGTAGCGAGCAAACCGAGAC
GTTAATGTTCTCGCCGTTGACTGTAATTCGCGCTACAACGGGCGTCATCACGTTCCGCGATGCAGTCTTCACTGCCGCTAACAGGACTCCAGAAGAAGGG
ATTTACACTGCGAACGTGTCGTGTGCGCTACCTGACTCAGAGCCGCGGGGCTTTGCCCAAAGTGTAAAGTTACTGCCGTGTCTACCGGGATTCTGGGTTA
ACAAGGGGTAAGGAAGTCTTGAGTCAAGCTAACTCTACTTGTACATTCACCGTTCACTAACCTTTTTACGATACTTAGGTATTGCGAACGCTGCTCCAAA
GACACGTATAGGTGCGTGCGTATTCGAAGCTAGGATAGAATCAAAGTGTACTTCTGACTCATTACGTACCCGTGTATACTGCAGTTTGGACGGCGAGAAG
TGTTTTAAATGTCCCTCCGGCGCCAAGTGCAATCAGAATGTACGTCGAGCTACGCAGACACTCGCAGAGGAGCTCGGTACGGCATCACCGCGCACAGAGG
AAGGATATTATCTGTTCTTTGCCCCAGCATCCAAGCAGGAATCCTCTTGTAAGAAGCCATCGCAGTGGAAAGATGAAGACCCATGCAAGAAGTCGGCGCT
AGAAGACCCCACAGCGAACCTGTCGGATATTATCCACTCCTGCTCCATTCACATTGATTTCGATGTGTACTGGCCTGCTGACCGCCTGTTCTCCTGTCTG
TCGGGGAAATCCTTCTACACTTGCGATGTGAGTCGGCGTTTGTGTTATTGATGGTAGGATAATTCCTCACTTGCTTTTGTTGCTCTTTTTTAGGTGGAGG
GGGCGTGTCATGCTGATATTTCATTGCAGACAATAGCACTTGCTGCCACAGTGAATAACGCCTCGTGTGCCAGTGGCTACGACCAAGCGATATGTTCAGT
GTGTGCCGACGGATACAAGCGAGCGAGGGACAATTCGTGCTTATGTAAGGAATATCCTGGCATTGCTCTTGTTGAAAATTATTTACCTGGAACTGCCTCT
TGTGTGTGATTATAGCTTGTGGGGAAGTGAATGCTGAGGTCCGAGCCTCGATTCGGTGGCAGAATTTCGTCATTCCGGTGCTTCTACTTGTTGCCGTAAT
TTGTGGGATTTTCGGCGTAAGAATTTATTTACGTGACCTCACGGAAATCAGTCTTTTGGTTAAAGCTGAAGCGGATAGACGGATGAAACTTGCCAACACG
AAGACTGAACGTACCGGTTCACGGATGAGTTCGAAGAACCGAAGAAAATCTATGGATAAGAAAGGGGTGGTGGATCGAGTCAAGGATAAAATCAGAGAGC
AGTATAAACAATTCCAAACTCGGAACCAGAAGATCCTTTTTGGCGTGGAGGTGGGCCCTCCAACCCGAACGTTCCCGATAACTCCGAGCAAGTTCAAGAT
CTTCATTGGCTTTTTCCAAATTTTTGGTAATTTTCAGAACTCTTTCGTGGTGAAATGGTCATCGAACGTCCAAAATCTGATGAATCTCTCGCAAAAGTTC
AATCTGGTACAGAATCTTGTGAAACCGTTTATGTTGATCAGTGAGTTGAAACTAACAAACGTATCTGTGCTGGTGAATCTAGGACCTGGTCGCTATCGCT
GGAATTGATTGCGTGGTCACGAAAACGTTTTACTTCGATTTTACGTGAGTTTTGCTATtttgcttgagcttgattGTTTATAATATTTATTATGAATGGC
TTTCTCTACGCTTTTTTTGTTTGTCAGGGTCACCATGAgccttgtcgtcgttgctcTCTCGGTAATCACTGCGTACTTCTACGCCGGCATGCGCAGTTAT
CGTGCAAAATTGCAGTTGATTCCGCGTAACTGTCTTCGTTGTGGACTTCCAGTGCTTGAAAGTGAGGCCATTCAAAATGACGATGAAAGCTTCAATCCCC
TTCGGCAACTACGCAGTTGGTGGAGAACGCACAACCTTTATAAACACAGCGCATCGGCCAGTCCGACATCAGCGGTGAAGAATACTCCGGAAAGCGAAAG
TTCGTCGCCTCGTTCGAGCATTAAGAAGATCCGAAAGCTGAAGCGCGAGTTCGGAATGTCCCAAATTCGCACTCCGTACCTGGGCTTGTTCCGCTCCGAA
CATTCGAAATGCCCGATTAAGCGGCATGTGCTCTCTGGTGAAATCCTTAAACGCATAATTCGCAGTAATCTTCGCGTGTGGCAAGCCCGGGTGAAGCTAC
GAATGAATTTCCTCACGTATCGTAACAAATGCTTGAAGCTCTACTGCTGGATGGCGTTGTTCTTGTATCCATCCGTATCCAAGACGATACTGACTATCTA
CAATTGCCAGGAGGTTGGCGACGTCTTTTACCTCGTGGTCGATCGTCGACTGGTGTGCTACAACGGACAATGGGCGATATTTGGGGTGGTTGCGACGATT
GGAGTCATCGTGTGGGTCGTGGGGATTCCACTTTTCTTCGGCCTTTTAATCTGGCTAGCACAAGACCGTGGTGTTGCTGCCCGTGTCAAGATGCTAGGAG
AGCCTTATATGCTTCCACAACGTAAAAAATGGTTAAAGGAAGTGAAAGAGCAGCATATTGCAGATAAACGGTTTGTTCGCGATATGGACAGCAGAGAAGT
GGAAAACGAAGAACTGGCGAAATACATGAAGCGGAAGAATTTGAGGGTATGGCACCCGTTTGTGAATGAACGTTGAAGAATATGGCACCTTAACGTAACT
GTTTTCATTCTGATACAGGACTCCACGGTTCAAGCTCGACTGGGTTTCATCTACGCTGAATGTAGGAACGAGCCAAAGCTCAAATTCTACAGTTGCTCAT
GACCGAATATGTTTGCTATTTTTTCCTTCAGATACGGATGACTACTGGTGGTTTGAAGCTGTGGATCTTTCACGAAAACTTTTTCTTAGTGGCGTGATCG
TATTCGTCGAGAATGGAAGTGTGGAACAAGTTCTGCTTGCTCTCGGTGTTTGGTAAGTtttacttgaagtatttaTTTATTGTTTTCATCGCGGTTGTGT
TCTAACCTATTTTTTAAAGCTTGGTGACGATGTGGTTTCTGCTCTACTTTCAACCCTACGATGGCTACTCGGATAATCTCATTGCTAGTATCACCCAACT
GCAGCTGTATTTCACTCTGTGGCTCGGTGTTATGATCCGACTAAACGACCTCAATGTCGAGTCACTCATTAACGTGCAGCTGCTGAGCTATCTACTCGTC
GGATCTTGCATTGCGGTCACGGCATTCGGGTTTAAATTGATTTTAAGTGAAGGCCTCGCAGAGTCAAGGCGAGTTTACACCGAGGCAGTGGCACAGCGCA
AGGAAAGACTCCGGTTTGAGATTCGCAAGCGATGGTTCCAGGCGATTGACTACGGCTTCTACGAGGCATACATGGGACGACGCTACGGCGGGAAGCCGAG
TTTCATCCATCTCAGCGCCGCTATGCGAGGAGCTTCCCACCAAGCAAAACTAcgcgagaaagaagaaaaagaaggagCTTTGCCTAAAAGAGAGGAGTGA
AGCA