Description :
From Genome Similarity Track
Location :
Scaffold_11:43603- 92487
Transcript NameFunction/comments
Phymu_g845hypothetical protein
Phymu_g846hypothetical protein PHYSODRAFT_309032
Phymu_g847hypothetical protein
Phymu_g848conserved hypothetical protein
Phymu_g849myosin-like protein
Phymu_g850conserved hypothetical protein
Phymu_g851phospholipid-transporting ATPase, putative

Sequence
48884 bases(100 bases per row)
ATGCTTCTGCACGTGCTCGTCCTGGCGGTCTGCGTATTGTCCCAGCCAGTGCTACCACAGGTCGTTTCGCGGTCAGGCTGCGCGTGCCAACCTCGAGTTA
TATCGGGCGTAAATACTGGCGTAATCTGCTATGAGGACACAGCCAGCTCAGGCTTCACGTGTGCGGTGAACCCGTTGGATCCCTGTGCTGACGGCGTCCT
CGGCCGAACATGGGATCTCTGTAATGGTACGTCGATTACCTGTATGTTACTTGCACGTGGGAAACACTAACATCGAACCTTCAGTCGTGAATTTGTATCT
CGTCAGCGACCGCAGCTCCTCTGCAGGCTCGGCGGGATCACTTGATGTAACTTTGTATGGAGAGAATCAAATTGAGCTGAAGACGGTAGAACTGTCGAGC
GACGTTCTTGAAAAGAAGATTTCAAAGGTGACACTGCCGCTGGATAACGAAGCAGTGGTGAAAGCTGTAAAGGTGCGTGTTTTGGAGGAAAATGGAGGTG
GATTTAAGCATCTCACTGGTACTTTTACTCGTCCAACAgattgaagctgcagcgaaaaCTTCGCTTCGGATTTTCGAAGTGCAGACTACGGTGAATGGAA
ATCCTGCTACGGTCTTTGCTTCTCCAACCCCACGCTCCATTACCTTCGtgggcagcgacgacacgaGCTCTGGGGTTGTGTCGCTATGGTTTGTGCCTGT
GACGGAGGCTCTAACTGGTCGGTGGCTTAGGAAGATGAATGGATAAAGGGGCGAGGGGTGACTAACGTCTTGCTGACTTTTAGGTACTGTTTTGAGTCAA
TGCTTGTTTGATTTAGCTGGGCGTTGTGGATATCACGCCGACTTGGAGGAGAGCTCTGGCGTGCTTTTCCTAGCGGAAGACAGCAATGAGCCAATTCTAT
CAGCAAAGTCAGCTGCTACACCTGCATTTCGACGCCTAACAGAAGTTGATACGCGCTCGAAATTCGAGCCACGGTCCCTGTCGTCGTTTCCTGCAGTAAT
TGGGCGTCCTAGTTATCAACCGACTGCTTCATTCCATTTACAAGCTGGAACTGCGTTACCTAGTGACGAGAGGATAGTTGCTTCTACTTCAAACGAACCG
GTGGAGGTTCGACTCAAGGATGTTCTGGACGATGTGAAAGAAACTCTCGAAGGAATTGATAGCTTTGATCTCGTATCGGTGAAGGTTAGCTGGAGCACCG
ACAGTGCTTTTAACTATGCTCGAATTGGTGGCGCTTCCTCTCGACTAGAAGCATTGAACGGCAGGTTTGTGACGATTTGGAGATTACGACGTCATGAAGC
GGCGATGAAGGTTTTTGTTTTACCAGATTTTACAGGAAGACACGACTTCATAGTCACAGTGGGCATCAAAACCGCAGGCAAAATGCAGCGATACTCCAAA
ATATTTTTCGTGACTATAGAAAAGGATTCACAGCCACAACCTTCAACCATTGGCGACGCAATGGAATCTCAATTagaagaggacgaagctTTTCAGGTCG
GCATTGATACGAAAGAGGCTCGCAGGCTCGATAGTTTGGACACAGCACATTCTAACGTGAAAAGAGTGGAGTTGCAACCCCTCGTTGTCGATTTACAAGA
TAATGAGCCATTTCGCCTTGTGGCATTGGATCTTTTTCCAAACGAACCAGATACAAGCACTGCGTTCTGTGAGACGAccttcatgatcttctcTGTATCC
AACGCCATTGAAATGCTGGCAACACCCTGGACAGGTGTCCACTATGTGACCAGCACTCATAACCCAGTTCTCACACATCTCTGCAATGAAACATTATCAG
CTACGCTACTGGCAAATGTGAAACACATACAGGCTCAGATCCAAGTTGTAATGATGGGTACAGATGACACCGTACTAGCTATTGCCAGCATTCCTGTTAC
GTGGTCTGTGATTTCCCGAGTCGACGTGTCATTTCCAAGCCAGATCCTCCTTGGCGCCCATAATATACTTGCTGGTGGAATATTGGAGCTGACACTGAAT
TATGCAGACTCTTTGGCAAAGTCCAGTGTAAACATCGTGGTCTCGAATTGCTCCTCTTTCGACATTGTAGCTGTGGGCTCTGCAAATCCAACAAGTGAGG
AGTGTACTTTCCTCCTGAAAGACACTGGCACGGTCGAGCCCGTTATCTTTAGTGGAATTAAAATCACTGAGCGCCAAGATCTCCCCGCGGTCGTTGACAT
CGATGTGATTACTTCTCAGTATGCGCAAGGTGAAGATGGCACCTCTTGGACTGTTATCTCATCTAGCGCTCTGTCGTCCACTGTATACTTTTGCGGATTA
ACACCGACGCCAGGAGGTCCACTACTCTTCCGTAAGGGTGACGTGAATACTGTGGATCTCTCTTCCATCGCGCTTACACTTCTTGGTTCCAACTTTCTTG
ATTCCCAAATTTTGAAAAGTGTTTCTTTCGTTTTGGACTCCACGTTGGCGTCGAACATAggcaccttcttcgtcaacagTGCTCATGCGCAAGTGGAGTA
TTACAACGTTACCGCTTTTATCGTGAGCTTACACGCAGATACCGGCAAAGATTACTCGTTCCTACCATTGCAGTACGGATCTTTTCTCGTCGATGTGATC
GTGGCGTGGGAAGGCCTTAGCAATGACAGCactggctgcttcttcgtgccgAACATTGTGATCTCAGTGATACCTTCCTTTTCCCAGCCAGTGTTTGCTA
CTCCGTATTCTTTCAATCGAAGAGTTGTTCAAGGATCATCAGCTCAAATTACAATCCcaacgatgacgacgacgaatcCAGACATCGAGTACGTTACGCT
GGCTGTAGCAGTGAACACGACCGATGGTGATGCAATCGTCATCAAACGAGATGGTGTTGAGTATTTTCCGTCGCCAAAGGACCAGCGCTACTTTCTGCTC
GTTCAGCGAGATGATGCCATGGACAGTGCTAGTCGTGTCGTACTCTCTGTCACTCCAAATGGGAATTTCACTGGAACGCTCCAGTTTGATGTGAGCGTAT
CTGCTATTGGCATGGTAGACAATGCTGATCCTTTTGAAGAGTTGGGGGCCGAATTAACGACGATTCGTGGGGTAAATATCGAGTGGATTCCACGAGCAGA
TTCAATGAGTGAGCCTACCGCTGCAGGAAAAGCAGTCTACCGAAGCTTGCCAACACAACTTCGAGGTGACTCCACGCTCTCGTTCAGGTATCAAATGTCG
TCAGGTACGCGACTTTATCCTTTTTCTTGCGTCCCCGGCGTTTCTAACGTTTGTGAACCCACCACAGGTTTTTCTAGTATTAGTACCGATGTTGTGCTGA
ACTCCACCGAGATCCGACGGCTGTGGTCTAGTGACTCAGTCTCTCTTACTGAAAGCGCATGGAATTATGCTGAAGCGTTGATTAAACTGCCGTACGTTTC
AACAGCCGAAATCGTGTTTCGTGGCGAAGTTtccgaagaagacgcactATACCTAAAAACTATCTCGATTCGAGACTACACCCAGGAGAGTATGGTTGGA
GAGATCCAGTTTATTCGTGCCACAGGGGGTATGATCTACGTCGAAGTCGTCACAGCGAATTCCATTCCAGAACCTGTTCTTTATCGTGCTTATGCGAAGG
AGGTGCGCAACAATGAGGCACCAACCCTTCGCTTCACAGGTAAACTCCTAAGATTTACTTTATTATGGGTAGTGGGTGCCTAACTATTATTCTATTGCAG
GCGATGCATTTCAGTATCTTGGTTGTAAATCTACCTCGTCAATGTATCAATGTGTCGGGAGTTCGGGGGTCTCATATCACGGTCCAAGTCAATGCCATTC
TTTGTGCTCGGCTACCGAAACGCAGCTTCAATTTACTTCCGAATCGATTGTGCGGAGTGAGCAGATGATAGCTGTTCCAATCAATGATGCTTTTACGATC
GAGTTCTGGGTGTACCTGGACAACTTGAGCTCGAGTTTCATTTACCAACAGCTCCTACTTCTCTACGGTTCACAAGAGGGGACCCTGAGTATCACGATAA
ACGGCGAACTGGTCATTTCACGCTGTAGTAACCAGCTTCGTGTTCCACATGGCCTTCCAGTACACAAATGGACCCACATAGCCTTTGTGTTTAGCGCTGA
CAACGAGGTGGCAATCTTGATACAAGGAGTTAAGATGGCAACAGGTTTACTGAGCAAGTCAAATTGTCCGATACCGACTTATGCGTACCTACAACTTGGT
CGAGGTACGATATAAATCTCTCTCACCTTCATGTATTGTTATCTGACTTCGTTTAATGAGTAGATGCTTTGAACATTCTATCGGATTCTTCTGCGCTGCA
AGGTTCACTGGATGAGGTAAGATATTTTGATGCGAAACACAGTAAAAGGTAAAAGACTCACATGTGGGTGAGTTTTTCCTTAAATCTAGATTCGGGTGTG
GAAAGTGGCGCGCGATCCGGCGGAAATTTATGCCTCGTACCAGCAGAATGTTGCCGGACCTGATTtgattcttcttctccttttcaaTTCTGCTGAGTCT
ACAAACTGGTTCCCATCAGGAGTAGATGGAAGCCCAAGCGGTGCGAAGTTTATGGTGCAAAATGTGAAAGCTACGAATACTCGGCCGATCCAAGAGCTTG
GGATGAGTGGAGATGGACATTGCTACTACAGTTTGTTTACATCCGCTGTCAGCAGTACGTCAATTACCTGCAATAAACCATGTGAACTTCATGGAATTCT
GAGAACGTGTGGGTCGAATACTACACCGTCAGTCGCTAGCGTGTACAGACAAGGCTCTATTGGCATCGGCAGGCTTTCACCCCTAACGGATTACGAACTC
TCGATTGAATTTGTGACTGAAAATGGCAAAGAATACGAAGTGACACAAACATCTATTGCACGCACGTCGAACGTGACAATCCCCGGGACAGTGGACTACA
TCGGTGTGGTGGAACGCTCAGCCGAACTGCTAGAACTTCACTGGAGCCCTGTAGATGACGATGGAGGGTCCGACATTTTGCgatattttatttttttcgA
TGGTATTAAAGTCGGAGAAAGTGGAAATCTTTCGACTACTTTCAACTTTACAGAGATGCAAAGCGGTTATACAGTCACCATTCAGGCAGAAAACGCGCAG
GGTGTTGGCAGTCAAAGCAATAGCCTTCGCTTAGATGCCTTGCACAGTGATCCTgctccacagcctccacaACAGCCTGCCGTAAATCATGTTTCTGGTG
GAAGCGTGGATCTCGTGTTGGACGAAAGCACGCGTTTGGCTGTTGAATATCGATCGTCTGTGGTAGTGATCGAGCAACGCGAAGCTCTTACGACATTCTT
CGCTCCTTCAGCATTTAAACTCAACGGAGCGTCAGCAACTGTTTGTAAGCTACGCCACAACACTGTTTACATTTTCCGTCTCAGTGTGATTAACGAAAAT
GGAGTTCAAAGTGCGTTTAGTGCGCCGAAGTCGGTAAGAACCGGAAACAGAGGAAGTCCAAGCAAGACACCATTGCCTTTGATATTTGGTGTCACAGGTA
TGTACTCCTAGTGTTAGTTTGCTTGCTATCCTCCTCTCCGTctcacttcttctttttaaTTCTGCAGGGGGGTCAATCAAGCTGGTACTGAATGAACCTC
TTGATTCAGGTAAGTGCTATGGTGTACCGCGATAGTACAAAAAGATGTTTATCTTTGTTTTTGATAGGCGGCCTCCCAATTGCTCAATTCAACCTGTTTA
TTCTCTACGATGGCTCGTTCACAAAGCTGAAAAGTATACTGGTATCAAGTACAAGTGTAACAACAGCTTTGGTGACACACGACGCAGATGGAAGCCCTCT
GCGTTCTCAAACGTCGTACATGTTCAAagcgttggcgctgcaggccAATGTTGTGTGCGACACCCTGACTGCGGATGATTTAGCGAGTGACACCGTAACT
GCAACGACAGGTGACGCTGCTATTCCCGCCCCACCGTCAGCCCCAGCTCTGCTATTACTATCCGGATGCACAGCGTTAGTGACTGTTTCGTCCCCAGACG
ATCTCGGCGGTGCTGGTGTCACAGGCTTGACTATTGGAATGTTCTTGTCTACGGGAGTCTTGTATGAAAGCTTCGCAGTCCCGTTAAACCCTGGAGAAAT
TACGATTCGAAAACTGTTAGCCAACACGAGTTACTCTGTACGAGCTGCTTTCACGACCAGTATTGGTGATTCAGGATTTGGCGAAGCACTGAAATTTGCA
ACGGCGAGTCCAAGTCCACCTGGGAATTTGAAGTCGTTGATAGTCGCTCATGCTAGTTCCAGTTGGGCGTATGTGCAATGGGAAGGACCGGAGGATACAG
GAGGGGGTGCCATCTCCGGTAACGTCTTATGACCATTTTTGTTTCATTGGTAGGATGGTAACATTTTTGCTGTGCTGTCTGTAGGGTATTTACTTTATCA
GCGCACCGCTCAGACGAGCATACCTCAAGAGCTCATTTACGATGGATCAAGTAATTCGACAACAACTTCGTATCTTGTTGAAAGGCTCCTGGCCAACACA
CTGTATATCTTCTCTGTCGTTCCGATCAACCAGTATGGTCTGGCTGGCTTCAATCCTAACGTTATCGTCGCTACtacagcagctgctgaagtgCCGTCTC
CTCCAACTAGTGTGAAGCAGACTCTCGTCAGTGGTGGATACGTGGAGTTCAGTTTTGTCGAGCCGTTTTCTACTGGTGGATTTACACTCACGTCGCTCCA
GTATTTAGCTCGCCTGGAAACGTTGTTTTCATGTTACAATGGCGCAACCAGTTGCTCTACGTGCACTCACGCTTTGGATGCTAGTGGTGCTATCGTGTCG
GTTGATGGCACCTCGTGTTCCTCGAGTAATAGTGCCGGTTGTTTCTTGAATGCTGGCACTGAGTGTGGAGTTCTACACACGGAAACGAGGGCCTGCACTT
CGAACACCCCAGCTGGAACGTGCCGTGTAGAAGGCTTGACGTTTCACACAACGTATATCGCATCGATAGCTGCGGAGAACAGCGTAGGGAAAAGCCCCTT
CTCCAACAGCATTGCCGTCACCACCACTGAAACTACACAGCCAGGAGTACCTCGGCTTCTCCTTGTGTCTGCCACTGGAGGTTCAATAACGCTGCAATGG
GAGCTTTCAGCGGTAACGGTGAAGCCTTATGAATGCTGGTACACATTGTAACTAATCTTGTTTAATTTTATTATTTTGCGTTTAGGATACGGGAGGTGTA
TCAATCGTGCGAATGCATCTTAGCGTGGATGGAGCCGAGCTATTTAATACGGAATCGGCCTTGACCTACACTCATTGTGGAGGCCTTGTGGCGAACACGG
ATTATACGTACACTGTCGAGATTGAAAATGCGGCTGGGCTTGTAAATCGAGCGACTTCTACTTTTTCAACTGCGGCATTAACTCCTGTTGGACTAATGGC
GATTTCAAAAACCTACGTGGGAATGAAAACAGCAAAATTTAGTGTCACGGTGCCGTGTGATGACGGAGGCGCAAATGGAGGCGTGTCCTTATCCTATCGT
GTCTTCCACGTTGGTGATGAAGCTACATTAACTAACGGATTGATTGGTTGCTGCTCAATCAGCATCACCGGACTGGAAGCTTCGAATGATTATCGTATTG
AAGTCCAAGGTGTGAGTTCTACACTTGCTGGGGAATGGTCAGCAATGAACTTCACCACTCTAACTGGGATTCCTTCAAGTCCCGATACGACAATGATGTT
TGTGACTGCAACGGCATTGAAACTAGCACTGATTCCTCCCTCCGTTGCAGGCGGCAGTCCACTGGCGATTGAGGTGATTGCTACAAGTGTTACTACTGCA
ACCACCGTCTTCCAGGACTCCTTGAGCTGTTCCATGGCCGACCAAGAGTTTGATTGTCCAGATACATTATCTATTGACAACATCGATACTACTGAAAATG
GATACACATATATCGTCTCTGTGAGGGCTGTTGGCGATGGAGGGTCGAGTGTTTGGGTAAACCAGTCGTACGATTTGGATGATGGAAAGCCTGGTAAAAT
TGGCTTTGTTGATTCGACAATTCATGGTACTGAAGGAAAAAACATTGACGTGAAAGTCGCTCGGATATATGGGTCTGCTGACTCGGAGCAAGCAGATTTT
ACGATAAGTGCTGGAACCATAGCTCCAAAATGGAGTTGTGAATCCACGCCCAACGGAGCCACTTGTTCTATTAACGCGGGAGGTTATAACTCAGGTACAC
ATCTTTTTGTTATTGCGGGAGAATATGAAGTGCTTAATGTCTCTCTTGCCTTACAGGACACGTCGTTTTCGGGCCTGGGGAGTATTTGAAGACTGTCACA
ATCTCAGCGTTTGATGACTCACAGtacgaagctgaagctgtgtcgctgaagctggttCTTGTGTCTACTACAAGCAGTGCGTTGAATAATGCGCAATGCA
ATGTCACATTTGATGATAATGGAGACGCAGGAACTGTGGGCTTTGAAAAAGCTGCAATAAATGCGGTCGAGAATCAGGGGCTAGTAAGGATTGTTCTGAT
GCGTACAGGGGGAGTAAGTGGCGTAGTGGCTGTAACGTTGACATCAACTGTCAGTTCGAGTATCAGTGGATATCAGCTGAACCAAGTGGTTTACTTTGCA
GATGGAATTAGAACTGCCACGAGGGATATCGATATCCGCAATAGCGATGCGTATGAAATCAGGCGCTATACAGTTATGCTCTCCAACCCCACCAATGGAG
CAACGACTAGTGGGAATCTTTCAGTGGTCATTCAAGATAAAGGAGATTTGAGTTTACCAGGTCTGCCACGCCCTTCAGCAGGATCGAGCACAGGTGGATG
TATCACGTTGGTTTTAAATCCACCAAAGTTTCTCGGTGGAAATCCGGTGTCGATTACTTACTTTGTTACGGTGCTGCATTCGGCCACCAGCTTCTATAAA
ACAAGTACCACCGAGGCGAATAGTATCGCCACGTGTGACCTCAAATCCAATACGACATACACGGCCAATGTTAGGACTAGCAATGGCTACGGATTAGGCG
GCACTCGGACTCTCAATGTTTCAACTGGAGATCTTTCGGCCCCGACTGAAGTCGTTCAACTCCTCGCCGATACCGTTACTAGTGGGTATGCGAAACTGTC
ATGGCTTCCCCCTCTTGATAAGGGCGGAATCGCGATTGCCACGTACAGCGTCAGGGTCTTGAACCTGCATTATAACGTGGCGCGAGACATTAAAGTGTCT
GGATCATTGCTGTCTCTATCTGCGGGTTACTTAGAGGTTGGCACGTGGCATACATTTTTTATTCGTGGGGTGAACAGCGGTGGATTAGAAGGACCAGAAG
TGAGTCTCAACGTGTTGACTGGGAACGAAGCAGTGGCACCACAGCAACCACCTCCGCCGGAATTGATATTCGCTACTGGTGGGGCATTAAACGTGAGCGT
GCTCGCCCCACTTGACTGTGGGGGGTTACCTTTGACTTCATATGTTCTCAGTATAGCTCGACGCATTGGAGGAACGTTGGAATACCGCCACTACGCACAA
AACAGCGTCCCGAGCTCGACTTACGGGGACCAAATTGTCGCGAACGTCTCCATTTACGGCCTGCTTTCGAATTCGGAGTACTTTATTATTGTGGCTGTAG
AAAACGCTAAGGTACCGAGCCCCACTGctttcatttttttttatgtGTATTAACGATTTATCACTGTTGCTACTAGGGATGGAGCAGTCCAAGCGATGAG
AAAGCCTTCTTTACCACTGACCCGACACCAGTTGGCTCGATTTCCCCTCCGGTGGTTGTACTGCAGGATCCTGGGGAGTTAACACTAAATTGGAGCGCTC
CTTTGGACTCAGGTGGCCTTGGCGTTGTTGGGTACAAGGTGCAGTCACGTCGCCAATTCCCAAATGGCTCCTGGTCACTTACCGAGGTTGTGTACGAAAA
CCGGAAATCGCTGGTGCAAACAGCGTTGATCCCGAACATTTTAGCCAATACACAGTACGCGTTCAGCGTCTCGGGGTACAATTTCCGAACCTTGTGTCGT
CCGGATGAAGATGTGACGCCGAGTGACGAACTTCTCATCAAGACGCAAGACGCGTCTGTTCCATCGCAGCCGAAAAACGTTCGCATGATTGAAGTGACTG
GCGGATCAGTTACTTTAGCGTGGGATCCTCCGCGCTCTTCAGGAGGGGAACCTTTACTATGGTATCTAGTCAATGGAGGCGCCGAAGGCAGCCCGCTGCA
AGTCATGGCGAATGTTAGCGCTTCTGCCCCAACGTCACTCACTTTGTACGGCTTCACGGCTTCTTTTCATTATGAATTTGCGGTAGCTGGAGAAAATTCT
CGGGGCTCTGGATTCTATTCGCCATCTGTGTATGTAACTACAAGCGGTACAAGTGCCCCAGGAGCTCCGAAACAATTGCGTCAAATCTCGGTTTCTTCCG
GTGGAACGATTTTACTTGCGTGGGAGCCTCCTGATGACTCGGGTGGTGCAAGCGTTACGCAGTATAAAGTGACCCGTGATAACAATTTCGTTGGCAATGT
GCTAGCTGCTCAAGGAACCACGAAGTTTCAAGACCAAGGCAACATTCTGGCTGACAGGAGCTATATCTATTCAGTATTTGCGTCGAATGATGTGGTATCC
GGCTCAGGAGCAGCTACCCTCATGGCTCatagtgctgctggatctgttcCTGCCGCTCCTTCGGCTGCGGCTGAACCAGGTAGTGGGTTTATTGGACTAA
GTCTTTTTGCTTCACCAGATACTGGCGGTCTTCCTCGCCTTCGTTTCGAGTTGACAATACTTCGGGGAACGTCGACGATCGACGCCTACGACACGACCGA
GACAACGTTCACAGTAACTGGGTTGTACGCAGAAACGGAATACTCCATTATCATCCGGTCGGTCAATACTGCTGGGAAAAGTGAAAGTTATACACTGAAA
GCCAATACGTCCGACGCTACAGTTCCCGACAAAGTCAACATCCCAAGATTAGTGGAAGTAGCCGGAGGTCACTTAACATTTGGAGTTGTCGCACCGGCTA
ACTTTGGCGGGAAAGAGATCACGGACTATAACTTTTACGTGAACGGAACGCTTGGTGTGGTGAAAAAGCGGTCGAACAACGAGTATGATCTTGTTGGCCT
CACGGCACTCACGTTTTACGCAGTCACTGTATCAGCGACAAACCGCCAGGGGGAAAGTCTTCAGAGTGATCCGATCGTTGTTTCTACTGAAAAGGTTACC
GCACCTGGTGTGGTGCAGAACCTCTCGACAGCTTCTGTTACGCACGATTCAATTATTCTCGTATGGAAAATGCCATTCGATACAGGCGGAGATGCAACCT
CTATTTCGTATGATATTAACGTGACCACAGCTGACGGAACAACTCAGACTACATGTGATACTGAGACACTGACGCAAAGCGACCTTGATCCGGCAACGGT
TTATACTTTTCAAGTTAGCGCAGTGAACGCTGCAGGCAGTGGCTTGTGGTCTCCAAGCTTATCGGTGAAGACGAATCCTGTTTCTCCTGGAATTATTAAT
TTTGCCAGCAGTGAGGTGGAAGTCTCTGAAAATGAAACGTCGGCAACCCTTACACTGCTTCGTACTCAAGGGGGATTCATAGCGGCCAAGTGTTTATATT
CTACAAGTGACGGAACTGCGCTTGCCGGGGTCCAGTACGTGCAAAGCAGTGGTGAAATCGACTTCGAACGGACTTCGACCTCAGAGTCGATACAAGTTAC
CATCCTTAACAATGAGGTGGCGGACGATCTAGACAAATTCTTTTTTGTTACGATCCAGGAATTTAACAGTGATTCTGGTGAAATTGGAGAAGTTGCTAAA
ACGAAAATTACGATTACGgatgatggagatgcagGTTTCCTTGCATTCGGACAAAATTACTATTCTGTTTCGGAATCGGTGTCTGCGCTATCTGTGAATC
TCGTGAGGACGGTGAAGTTCAGTGGCAATAGTGTGGTCGAAGTTGACGTGGTTGATGTCCCTGACGGCGCCGTTGAAGATGTAGATTACGTCATTTCAAA
CAAGACCATTGAGATTGCTGATCAGAAAAAGCAAGGATCAATCAGTATTTCGATTATAAATGATTTAACGTATCAAGTCCAAAAGATattcaagttgaag
ctccGAGTTGTTAGTGGACGAATTGCTGTCGATGGTTCGAACGTGGTCGCTACAGTTGAGATTCTAGATGACGGAGATGTATCGCCCCCGGGTTTGGTCA
CAGCGATTGAAGCTCTTGTCATTTCCGGGGGAGTTGTCAACGTTTCATGGGTGGCCCCGGGTTATTTGGGCGCGAAAGCTGGTGTGTCGTTGTCATATAC
TGTGCGTGTGATGGAAGTTCAGACGGGTTCGACCCAAGAGCTACCAACTAGAATGGTCAATATTGTCATTCCACAGCTACAAGCACGAGCAGGTTATACG
GTTTCTGTTGTGGCACATAATGGGTACTTATTAGGAAACTACGCTACCCCTGTGGCCGTTTTAATGGGAGCTCCAACCCCTCCATCGAAACCTCTGGATG
TACAAGTTCTGGCAGTAACCGGCGGAATGGCAACTTTGTTGTGGACGTCTCCGTTTGATTCAGGAGGTTCCTTCATTGGAAGTTACCGCGCAAATGTTTC
GGCTAGCGATGGAGTTTTTGTGGGCTCTTACACTTCAAGTGGCAATACCGTATCGACAAACAACTTCAGTCCGTTGACAAGTTACAGTGCAACTGTCGAA
GCTATCAGCATAGCCGAACAAGTTGGAGCAGTCAGCACCGCAGTCTCTTTTACGACGACGTCCGCTTCAATTCCGGGAAAACCCACGTCATTGAAATCAT
CAAATGAGACAGGAGGAGTGTTTCTGGTTGATATGGCACCACCTTTGGATATCGGAGGCATTCCAATCTTGAACTATACGCTGCTAATGACATCGGCCCA
ATACCCAAATGTCTTTCGCCAAGTTTATCAAGGCCCCGCCTCCTCATTTCTCGCTACGAAATTAACGTTTTCTACAACGTACAAGCTGCAGTACAAGGTG
ACTAACAGCGCGGTAAGTTTTTATTCGTTTATTTACTGCACGTAATGCCCATAGAAATCTGACTACTTCTTGCTTTTAGGGTACGAGCGAGTTAAGCGAT
GCATTCACTGCGACCACGAAGTATTTATCTCCACCAGGACAAGCTCAAAACCTTGTACCACGTTCACGTACCGGAGGTTCTGTTACCTTTTCTTGGACAC
CCCCTGCGGACTTTGGCGGCGTTGACGTTACGGCGTACGACATTTCATTCTTCCTTGGCTACGAAGTCAAGGCTCAGTATCGTCAAAGGGTATCGGGAAT
TAGTCCGCAAGCAACCTCAGTCACTGCGAAAGTCGTGGGGTTGGTAGCTAATTCCACGTACGGATTTTCCGTCTCTGGTGTCAATGACGCGACGGTATGC
GAGGATCCTTCAGCACTTCTCACTCGCACAATCGTTTACGATAGCACGGATCCATTAGTTTCGGTACCGGACACTCCGACGAGTTTGGCCGTTGTTTCAA
GTACATCAGGCATGCAAACAATTAAATGGGCGGCAAGTGAAGACACCGGAGGTGGCTTGCTCCTATCGTACGTGCTGTACTCAAGCACAGGCGATCTTTT
GTACAATGACACGAGTACTACGTATACGCGTGGGTCTCTGATAAAGGACACGACGTACGGCTACAAAGTGGCAGCTTGGAATGAAATGGGGACAAGTACA
CAAAGCTCACTGGTATCTGCTACTACGAAAGCAGGCATTGTTGCACCTAGTCAACCGCGCGAGCTTACAAAAGCGAAATCGACTGGAGGATCCATTAGTT
TAACGTGGAAAGTACCCTTGGACAGTGGTGGAGATACCGTTTCAGGGTACAAACTTCAGCGTAATGGTACTTGGAGAGCGGACATACCAGCGGATGGGGC
AACGATGATGTACCTGGATGACCAGGGACTTGTTGCATCAACCCAGTACGTTTATGTTGTTCAAGCAAGCAACTCAATTGGACCAGGCGCTGTGAGTCAA
ACCTTACTAGCTTCTACAACTGATGCTACTGTTTCAAGCCCCCCAACTCGACTAGACGTCGTTGCGAGGGGAGGAAATTTGACTGCAACTTGGgttgctg
cttcaaataCTGGTGGGATCGATTTGACGTCTTTTCACCTTACTGTCAAGGTGGATACGTTGAGCAGTGGGTTTAGTACGACTACAAACACGTCTCAATT
AACCTACACTCTGTTCGGTTTGAGAGCGAAGAGTTCATACACGGTGAGCGTGACTTCAAAGAATGCGATGGGGGAGAGTTCACCAACGACCCAAATTGTG
GTAAATGGGGCTGCTGTctctcctgcagctccaccagtcCCTGAACGCATTACAGATAATACTGGACTGCAAGCTTGGATGATCATGCTCAAGTTGTATC
TCCCTGTGGATGACGGGGGAGCTCCGATATCGAAGTTGAATCTTTATCAGAATGGAGAGAATAAAAGCTCCTACTTGATTGAATCTTCAAATAACCAAGC
AGAGCTAGGAGACCCTACAACTCGCTCGATGCTGGTCCAAGTCGGCCCTCTACATGCAGCTCGGCCTTATTTTTTTGCGGTATCTGCTCTCTCTTCTGAA
GAGGCAGTCGGGGAAGGAGCTCGCAGTGATGCACTGAAAGTACTGACAAGTCCAGCCACGCTTCCTTCAACCCCTACAAATGTTGGCGTTTCGCTTCGGA
CGTCGTTCTCGATATTCCTGCTGTGGGATGCTTCTAGCGATACcggtggagatgaagtcgtgtATGAGATTGCTTATACCAACACCAACACGACACAAAG
TGGGCAAACAGAGACCAGTAAAACGACAATTGAGGTGCCCAAACTCAGTCCAGGCGATGTTTATTCGTTCCGAGTGCGTGCTCGAAACTCGGCTGGAGTT
AGTGAATGGACTTCCGACATTTTCGCTGAAACGGACGTGACCCAGCGTGGTGCTATTGTTTTCAATGTGGAGGCGTTGACAGTGTATGAGAATGTGAGCT
CCGTGACGGTCCAACTGCTTCGTGTGAACGGATCTTCGAGCACAATTACAGGCACTTATACGGACGGTCCTGGCACAGCCACAGAGGGTCAAGACTACAC
TCTGCCTCTTGAATCAGCTCGATCGTTTACGTTTGTTGGGGAAATAACCGTCCAAAGCTTCGAAGTGACAATTATTAACGACGAGATATACCAACCGAGC
GAACGGACGATAAACCTGACTCTGACGGATACAACCCCTGGCCGTAGCGACCCGTTTCCCTCAACATCGCTGATTATTAAAATACGCGATGATGGTGATG
CTGGGACGATCGGATTTGTGGAAAATGAAGTTGCTATCGCTGAAAACGCGCGCATTCTacctctgcagcttcaacggctcAAAGGGAAAAGCTCAGCAGT
TAGTGCTCGGATCATTCTTTTCACTGGTCTCGACAGCACAACGCAGCCCGAAGTAGGATTTCGCCTACCGTCGACCACTGTGGACTTTATCGATGGCCAA
ACGTCCTCGTCCGCAAGTATCGTGATTAAAGACAACGACGTCTACGATTTCCCGTACCTGTACTTCTACCTCACTCTCCAAATTTTCTCTGGAGGAGCAA
CTGTGGGGGCAAACAGTGTGCTGAAAGTTGTGGTACAggacgatggagatcgaTCCGTACCAGGGGTAATGAGTCCCCCAACGCTGGATAAAGCAACAGG
GGGAATGCTGAGATTAAATTGGAACTCACCAGTTAACGTTGGCGGACAGAGTCTGTGGATCAGTGGATACAGTATTTCTATTCGCGTTGTCAACTCAACA
AACACCATAGCCACATCAGATAACACCACAACGTTCCCGTTTGGCGGGTTAAAGGTGCTCACCACATACACTTTCACTATCGCGGCTGTCAACGCAGTTG
GGCGTGGAATTGACTCTCCTAGCGTCTCATTTGCTACGACGAATATTACCGCACCAGGCCCAACGAGACAGATTACTTTGGCAAATCAAACTGGTGGATT
ACTTACCGTAAATGTGGCCTCACCAATTGACACGGGAGGGGCTCCAGTCGTTGGATACAAAGTTTATCTTGCCGGGGAAAGCGGGGATTTTAAGGTATGG
ATACTTGATACTGCTGTGGCTGAGAGTTCTTTTAATTTATGCCTTGTCGTATTTGTGTGTGTGAAGCTCGCATACGACGGGACGGGTCAACCTTTGTCAG
TGATACCTGTGAGCGTTAGCAAGCCAAACACGGTTTACCGTTTACAAGCGCAGGTTTGTCTCGAATTGAAATTGTTTATCATATCTTCGACATTGACGTG
CGTTTATATGTGTATAGGCAGTCAACTCTGTTGGCGGTGGGGATGTCTCCGAGTCGTTTAGCTTTGTTAGCGGACCTTTGTCAAGGCCTGGACCGCCCAG
ACTGCCTTCTACGTATTCATCTCGAACGGGAGGATCAAtatctcttcttcttcgacctCCACTTGATGCAGGTACGATCCGTACCAACACTTAAATTAAT
TACGCACATATAAATGCCGTATATGGACAGGTGGCCACGAAAAGATCTCATACATGATTTACTACCGCGAGCAAGGTCTCAGGACGCGTTTTCGGCAGGC
TTACAGCTACGCAGAGGATACAAATATTACGATCTTCCGATTGGCCGCGGAAACTACTTACGAGATGGTGGGCGTGTCGCTTCTAGACAACGATACAAAC
GCCCTCACTTGGGGGAATATTTCCGTTTCCGACTCTGTCGTTGCACTAAACAAAAGTGTGGCTACTGACCTTGTGAAGAGCGGCTATTTCGACTTCGGTG
TAAGTTTCTGCTGATTTCTCTACTCTCAAGATTTCACTAACTAAAGTATTTGCTTTTAAACTTAGGGATACCTTTTCGAAGTCGACTTATCTGCAGCTGT
AACCAACAACATGATCGACTACTCGCCTTCCTTGAGTACGGACGGCGGAGCAATCGTCAGCACTAACCTCCAAAATTGGGATACCTATGACGTATTTGTT
CGCGGTGCTTTCAGTACAATGGCGACCTTCAACACTGATTCCCCTACCAAACCAGGAATGCCTCCTGAATCTACACTAAACTATGGCACAGGCGGTGCGC
TCCATATACGCATTTCCTGGCCAAACGATACTGGTGAGTAAACTTGAGTTTGCTATAGGTTGTTCCTAACTCTTTTGCTCTTGATGGTACTATCAGGTGG
GATCCCAATTACGGGATATACATTTTTTATCGACAACAAAACGGTAATTAGTTTGTTACCAATATGCTGACTCACTCTGTACTCAATCTAATTCTTCTTG
GATACACAGGTTGATGGGTATCTATACGAGTATAACTCACAAAGTCAATTGGACCTTCAAGTTACTGTGGAAATTGGCGGGTTGAGTCCCGAAACAACTT
ACAGCTTTTACTACATCCCGTTGAACGATGCATCGGCGTGTCCAGGAGGCGATGAGAAGCTGCCACTACAGTTTCGATTTTCGACTGGGGTGGCATCTGT
ACCGACGAGAATCCAGTTGATACGATCTAAAGCTGCTACTGGCGGTGGAATTCACGTCGACATCAAGCCGCCGATCGACAGAGGAAGTGACCAAGCCCTG
TACTACCAAGTTTATATGAGCCCAAGTCGAGGGACTCCCATTTGGGGGCTGGTGTATAACAACACCCGCACATCCTATTGGCAaacgaagctcgagaagg
aCACTGACTATATGTTCATAGCTTCGTGCATGAATGAGGTGGGCTCTGTTCAAAATTCGTCATCTTTCACGCTTCGAACCACCCTCATCTCGCCACCAGG
TCCACCGAGTAATTTAAGCTTTATAAACGCCACAGGGGGGTTGGTCCAGTTCTCGTGGAATAGCCCCGACGATGATGGTGGAAGTCCAATTACCTACTAT
CAGGTGAGGGCCGTCGATATAAGTGGAGAGCGGGAGCTTGTACAAGAAACCACGTTGACAAACATCAGCTTTGGAGGACTTCTAGCAGACAAGAATTATG
AGTTTAAAGTGTTCGCTGCTAACAGTTTGGGAGTTGGATCGGATGCTGGGGTGGGACAGTTTCCAactactgcagcaactcTACCGTCGCTTCCCGGTGC
ACCAATTGTCCAGAAAACGTCTGGAGGTTCAGCTACACTGGCAATCCAAGTACCACAAGATACGGGAGGCATCAACATTGCGAAACTCTTGTGGAATGTG
TACGCTAATGGTGTAAAACTCCCTGAAGATGCTGTGCGTAAATCAGTGGCGGCAACTGCTTTAACGGGCGGTTCTCGTCGTTTGGAGTCAAGGCGATTAG
CCGCAGATGATGGATCGATGGTCTACCTTCAAGCTGGAGGGTTACTCCCATCTACTACTTACTCCTTTACAGTTCAAGCTTTGAATACTGTCGGTGGAAG
TGACACCACTCATGGTACTACTAACTCGACCTCTGTGGCTACGGTTCCAGGACCCCCAGAGCCACCAAAGTCAGTCGTAATCACCGGTGGAGCGATTGAA
GTGTCGTGGTCCGATCCAGTAGATACGGGCGGAGTGCCATTGACTGCATACCGACTCAGTATGACACATTTGGGACAGGAAATGGGATTCTGCGAGGGTA
TGATCCTTTCGTGCACTATTGGGAATTTATTATCGATTACGGATTATCAGGTAACGCTCTTCGCAAACAACACCATCGGTATGTCTCCCCCCAGTGCTGT
CACTACCTTTACGACATCAAATACTTCTCTCCCTCGGGCCCCACAAGACGTTCACGTTGCTGAGATCGAAAACGTTTACGTCTCTATCCACTGGTCCCCA
TGCATCGACTTTGGTGGGGGCTACGTTCAAACCTACCAAGTTGACGTCGTACAAACGTCAGATACCAGTATTACGTTCACCACAATTGTGCCCTTAGTAG
TGGAGAACTCCACGATTACTGGGTTGACCCCCGAGACGGCTTACACGGCAATGGTGGTAAGTTTTATTGTGGTAACTACTGAGCACGGGAAAACAAATCA
TTTATTGTTTACACGCTATTGTACAGCGAGCGGTGACTGGAGATGCTCAACTTGGAGAGCCAAGCAATATTGTATTTTTCACAACCCCACGATATGCCAA
TCAGCCTCGTCCCCCAGCAGTTGGGTGTCGTAAGTACATTTTCAAAAGTTGATGTGTACACTTCTAATCCAAATTTGTCCTGACTTCTTTTGTAGATTCA
CGAAAAGTGGCTATTGTCTTTTGGGAAGTTGACGACGATGCCCTTAGCTATTTGCTGTATCGGGATGGCGCGCTTTATCGGGATAACGGACTCGATATCA
CGTACGAAGATGAAATTGTTCTAGGTCAGACATACACCTACCAGCTTGAATTATTACACCCTGGCGGTATACGAAGTTCACTAAGTGAAGCCACAACATT
TGTCGCGACTACCCCTACCACAACCGGTTTCGATTGCGTCGGCAATAGAGGACATATCCACTGGCATGATTACCAAAATTTGGACCACGAGATGTGGACC
ATCGTACCCCCGACTCAATCCGGCTTGTTACTCAGCGTAAGTTGCCTACATACTATACTGTATGCTAAGCTACCGGTGAGAAAACTAACCGTTTTCTGGT
GCTTAATTCTACCTAGTTCTCGATGTTTTGGCTCGAATGTGATCACGACAGTTTAACGATTGACGTGACTACGAATGGTGTGATGAAGAACCTCTGGAAG
GGAGGTTGTTATCGTAACGGAAGTTTCGCTGTGACCACTGCAGCTGGGATCGAAAAGGTAACTCTTACATTCAATTCGGATAAGAGTATCACGTACGAAG
GGATGGCGTTGCATTACGAAGCCGTCGATCCAAACGATGCGGTGGAATCGGTGTACGCCCCCTGCCCCCTCTCGTCCAACGGGTATTGTTCATTGAATGG
CGCATGTCGAAAGGGTTATTGCTCATGTTTCACCGGCTACGTAGGGGAGAGCTGCACCAACGTCGTTATCTGTCCCGAAGACCTGTCAACGTGCACCCAG
ACATCGTGTGATCCAGTTTGTCTGCAGTCTGATACTAGCGTTATTGTGGTAAGTGGGAATGGAAATGATACCCAGGGAACGGGAGAGCGTATGAACACGT
CCCCCAGTGGAACAGATCCCAAAGCCGTGAGATCACTTCGACGGGCTTTAGAGCTTGCGGCATCCCATCAGACGATTTTGCTCTATCCTGGCACCTACAC
TGGCGCTGATAATTGCGGTCTATCTGTATCGATTAGCACGCTAATTATTCGAGGGTTGCGAGGTCAAATTGTGACGACGATAGATTGCGAACGGGTCCAC
GGGGGTTTAACCATTTCGAGCGGCCCAGTTCGATTGGTTGGATTAACGATACAAAATGCTGTAACATCTACGAATGGAGCTGGAATTAGTGTATCAAACT
CAGAGTTCACATTGGAAAGCAGCACCATCCGCAACGCCAACGCAGGTCAAAACGGAGGAGCGATTTACGCGATTCAAGCACAACTGAAGCTGATTAATAC
CGAACTCTCGAACAACTTTGCGATTATGAATGGAGGCGCTGTTTTTCTGGATGGGTCGAGCTTGAGTTTAGACCATACAGTCATCAAGTTGTCTTTGGCG
CGTGAGGGAGGTGGAATATACGCGCAAAACGTCGTAACTATGAACGGAGATAGCGACAGCAAGATCCGAGATAACTCTGCTACAGTGAACGGGGGTGGAC
TCTGTGTAGCGGGGACTTTCACCGGCCACACCCTGACCATTTCACATAACACTGCGGTGGTAGGAGCTGGTATATCGATTACCAGTGGAAGTTCAACTTT
TGAATTCGTGAATATTCTCGATAATCACGGACTAAAAGATGGAGGAGGTATTGCACTCCTTAGTACGGCGGGTCTGGTGCTTAAAAACTCGCCAATCCGT
GCGAACTCTGCCGTTCGTTATGGCGGTGGAGTTTTCATGGGGTCCAATGGCACTTTTGAGAATAACCTCGCATCTGAAATTTCCAGTTGTACGGCGGGTA
AGTGGCAAAGAAAACTTGATGTTGTTTTTTATATTACTGACGAAAATGTTTGTGGGTTTTGCCTAACAATTAGCTTCTGGTGGTGGGTTTTATGCTGCGG
ACTGGACAAGCCCAACCGTTAACAACCTCATTGTACATTCTTCATCAGCTACGACATCGGGTGGCTGCGTTTCATTTTCTCACAGCACGGCAATTTTAAA
TAACGCAAAACTAGACCAATGTGATGCGCCTGCAGGGGGTGGCTTGTATGCTGGTGCTGAGAGCAAAGTATCGTTGCTCTACGCGATGATTAAAGACTCT
AGAGCAACAAGTGGAGCCGCCATGTACGTCAACTCGAGCTCGGTGGTTGGGGCAAGTGATACACCTTCGAAGATCGAAAATTGTAAAgctacagctgcag
cggGGGGAGTATTTATCGCTGGAACTCAAAGCTTGTTACAGTATTTTAACGTGGAGAGTTGCTTGGCACCccttggagctggagtttTCATGCAAAATGC
ACAAACTGCGACGATAGAGTCTGTAAACATCCTCACGAATACGGCAGCCAGACACGGAGGGGGATTATATGCTGAATCCTCTACAATTTCGTTGGGGAGT
GTAGTTGTAAAATCCAATAACGCGGTAGTAGGGGGAGGAGTGTACGCGATCGACTCGAGTTTATCGGGTACCATTACATTACGCGAGAATAGTGGTAATC
TTGGAGGTGGAGTTGCTACGTCTGGTACGACACAGTTGGAAGGAGCTATTATCGAATCGAATACCGCCACGCAGAGAGGAGGTGGGCTAGCCGTCGATTC
AGGAGTACTATCGCTGAAGGCCACCACAATCCAACTGTGTGTCGCTCCTTCCGGCGTCGGTGGAGGTATTTCAGTCTCGAACGCTACTTTAAAACACTTT
GCAGTAGCTGTTAAGCTCTGCAAGGCCTTGCGTGGTGGAGGGATGTACGTAGATTCATCGGAAGTTTATCAATCCCCCAGCCAGGAGAGCAACGGGGTGA
GCCGAAATGCTGCGATTCTTACTCAAAACGATGCGGTTGAATATGGAGGCAGCGTGTTCGTTGATGGGGAAGGAGCGCTCGTGAGCGATATTGTCGTTAC
CAAAAGTACTGCACCTTCTGGTGCTGGCTTAGCCGTGCTGAATGCTCTCGCTTGTGTCATTCTGAACGCAGATATCTCGCTCTCGACTGCTACAGTTTCA
GGAGGCGGTGTATACTTCGGATCGGGCTCAAATTGTGTGCTTCGGAACTCGTTGATTTCTAAAAATCGAGGTGGTCAATCTGGAGGTGGGGGGATGATTG
ATCAGGCTACAGTATATCACTCCAACGTGGAAATCTTCAACAACATGGCTCCTATGGCTGCAGGAGTTCAATTGACTAGTGAAACGCTACCGGTGAGTTT
GTTATCGTGGGATGACGTCGCAACCAAAAGGTCACGTATCGACGCGAATGTTATCGACCCAATAACGTTAGACGGCAATGGAGCCAATGTCGGCTTCTCG
TGTTCGTTAAACTGTACTCTTTCGGGGGTTGTCGTTTCTGGCGCCAACTTGCCAACAGGACAAGGCGGTGGCGTATTCATTTCCGGTCTTGGCAACACGA
CCATTTCAGACTCCCTTATTGCGAATAACTACGCTGCACAAGGTGGGGGAATTGCAGCTAAAGACGCAAACACAACTCTTCTCCACAACGTGGCTGTAGT
CGGAAATGGCGCAAGGGATAACGGAGGAGGTTTGTGTGCAACCGGTGCTGAAGTTTATCTTATGAGTTGTGTATTTTACAACAATTCAGCACAACTGACA
GGCGGGGCGATCGCGGTGTACGGAGTATACATGGAGAGTTCTCAGTTGATGGTGGTGGAGAACCACGCTGGGGATAATGACAGGGGTATGGGTGGCGGCC
TTTACGTGGATAAACGTCTCAGTCCAGATACGACATCTGGCGTGAGCGCTGATACGTGGTTGTTCTTGTCAAACGACGCTCTTGTCGGAGGatccattgc
tgcagttaAAGGCTCCGAAATAAGTGTTTTGGACTCAAATATCACTCGAGATGCGGAAAAATTCTTAACAAAGACCTGGCAGGACCTTTTTGAGGACCTT
GTCGGCCTCAAATACGCCGCAGGACGAGCCCAAAACCGAGTGGACGTGCAAAAGGGAGATCTTGTGTATCTCTCGGATTTAAATACGATATTCGAGCTGA
TTTCTTCATTCGCAAGCAACGGCTCAGCCGACGCAGGAGGAGGCTTTTATGTTAACGCCAATGCGTTTTTCTATTGTGAAGACTCGGAACTGAGCTCTAA
CACGGCTAAcgagcgaggaggaagcgtGTGCTTATCCAACGGTGCGTTAGCCCAGTTCGAATCCGTCACAGTACGACTTAGTGGTAAGAAACGAGCTTTT
ATCGATGTCGTTGTGGTTGTCTCCTTAGCTaacttgtttttttttaacgTCCTCAGTTTCCAAGACTTCCGGGGGCGGGATCTTCCTTGACACGTCCTCG
ATATTCCATGCACAGAAGCTGCTACTCTCTGAAAACTTTGCCGATGACTCGGGAGGAGGAATTTACATGGACACAGGCAATAAAATCGCTGTCCAGCTGA
ATGATTCCATGATAGCACGCAACATCGCTCACGGCCAAGGATGCGGTACGAACTGACAGCTACGTTTTATGTCAAAACGCGTTCGCTAAACGAGATTTTC
TTGTGATTGACACAGGCATCTTCGtaggccaagaagctgtttTGGTGAGCTACAAATCCAGATTCATCGGCAACGGTGGTGTCACTTCCAGTGGGAAAAA
TGAAGGCGGAGGAGCGATTTCCTCCGTCGACGGCGTGTTGAAGCTCACTGAGTGTTCGCTTATCAACAACACTGCGGTGGTTGGAGGTGCCATTAACGTC
GATCGCAGCGGTTCGGCGACGATCATGGGCTCGAATTTCACAGGAAATACTGCAGATCAAAACGGCGGCGCAATCACGTTGAATGCCGAGTCGAAGGCCA
CGATAACGCAGCAAACCCGGTTTACGCTTAACGTTGCGAGCGCAGGTGGCGCCATCGCTGCAACTGGCGCTTCTTTACTAAAACTCACACTCGTAGTCTT
CCAAGAGAACCAAGCCCATGAGAATGGCGGGGCTCTCTATTTGACGGATGAAGCTACTATCGCATTGAAAAGAGGCGACttgagcaacaacagcgcGAGG
TTGGGAGGGGCCCTCCATTCAGACGAAATGGCGACGGTCAGGATCTACACCTCCAAGTTTATCACCAATGCGGCGTACATGCGTGGTGGAGCGCTGTACT
ATGAGTCGATTGCGAATACTACCACGTCGGGGATTACGTGCAAAGGCAACACGGCTCCAAGTGGCGGGTGCATCTTCTGGATATCGACGGATGAAAATCT
CACGTCTATCAACCCGTGTACGTCGTGTTTGATGGCGTCCAACGAAGTGTACGACATCGCGACCAACACGAGAGACGTCCACGTGATGTGGTGGCCTGAA
AACATCACCAGTGGCGTGAAAATCCTCGAGTCACCCGACGAAGAGTCCATTGTCGCTCTCCCAGCACGGAATTTTACTCTCGAGTCGACGAAAAACATTT
GGCCTCGCCTGAAAGCTGTTGATCTCTAcggccaagttgaagttttggATAATCAAACGGAGTGTTTCATGACGAACGCTATGTGTAGCGAGCAAACCGA
GACGTTAATGTTCTCGCCGTTGACTGTAATTCGCGCTACAACGGGCGTCATCACGTTCCGCGATGCAGTCTTCACTGCCGCTAACAGGACTCCAGAAGAA
GGGATTTACACTGCGAACGTGTCGTGTGCGCTACCTGACTCAGAGCCGCGGGGCTTTGCCCAAAGTGTAAAGTTACTGCCGTGTCTACCGGGATTCTGGG
TTAACAAGGGGTAAGGAAGTCTTGAGTCAAGCTAACTCTACTTGTACATTCACCGTTCACTAACCTTTTTACGATACTTAGGTATTGCGAACGCTGCTCC
AAAGACACGTATAGGTGCGTGCGTATTCGAAGCTAGGATAGAATCAAAGTGTACTTCTGACTCATTACGTACCCGTGTATACTGCAGTTTGGACGGCGAG
AAGTGTTTTAAATGTCCCTCCGGCGCCAAGTGCAATCAGAATGTACGTCGAGCTACGCAGACACTCGCAGAGGAGCTCGGTACGGCATCACCGCGCACAG
AGGAAGGATATTATCTGTTCTTTGCCCCAGCATCCAAGCAGGAATCCTCTTGTAAGAAGCCATCGCAGTGGAAAGATGAAGACCCATGCAAGAAGTCGGC
GCTAGAAGACCCCACAGCGAACCTGTCGGATATTATCCACTCCTGCTCCATTCACATTGATTTCGATGTGTACTGGCCTGCTGACCGCCTGTTCTCCTGT
CTGTCGGGGAAATCCTTCTACACTTGCGATGTGAGTCGGCGTTTGTGTTATTGATGGTAGGATAATTCCTCACTTGCTTTTGTTGCTCTTTTTTAGGTGG
AGGGGGCGTGTCATGCTGATATTTCATTGCAGACAATAGCACTTGCTGCCACAGTGAATAACGCCTCGTGTGCCAGTGGCTACGACCAAGCGATATGTTC
AGTGTGTGCCGACGGATACAAGCGAGCGAGGGACAATTCGTGCTTATGTAAGGAATATCCTGGCATTGCTCTTGTTGAAAATTATTTACCTGGAACTGCC
TCTTGTGTGTGATTATAGCTTGTGGGGAAGTGAATGCTGAGGTCCGAGCCTCGATTCGGTGGCAGAATTTCGTCATTCCGGTGCTTCTACTTGTTGCCGT
AATTTGTGGGATTTTCGGCGTAAGAATTTATTTACGTGACCTCACGGAAATCAGTCTTTTGGTTAAAGCTGAAGCGGATAGACGGATGAAACTTGCCAAC
ACGAAGACTGAACGTACCGGTTCACGGATGAGTTCGAAGAACCGAAGAAAATCTATGGATAAGAAAGGGGTGGTGGATCGAGTCAAGGATAAAATCAGAG
AGCAGTATAAACAATTCCAAACTCGGAACCAGAAGATCCTTTTTGGCGTGGAGGTGGGCCCTCCAACCCGAACGTTCCCGATAACTCCGAGCAAGTTCAA
GATCTTCATTGGCTTTTTCCAAATTTTTGGTAATTTTCAGAACTCTTTCGTGGTGAAATGGTCATCGAACGTCCAAAATCTGATGAATCTCTCGCAAAAG
TTCAATCTGGTACAGAATCTTGTGAAACCGTTTATGTTGATCAGTGAGTTGAAACTAACAAACGTATCTGTGCTGGTGAATCTAGGACCTGGTCGCTATC
GCTGGAATTGATTGCGTGGTCACGAAAACGTTTTACTTCGATTTTACGTGAGTTTTGCTATtttgcttgagcttgattGTTTATAATATTTATTATGAAT
GGCTTTCTCTACGCTTTTTTTGTTTGTCAGGGTCACCATGAgccttgtcgtcgttgctcTCTCGGTAATCACTGCGTACTTCTACGCCGGCATGCGCAGT
TATCGTGCAAAATTGCAGTTGATTCCGCGTAACTGTCTTCGTTGTGGACTTCCAGTGCTTGAAAGTGAGGCCATTCAAAATGACGATGAAAGCTTCAATC
CCCTTCGGCAACTACGCAGTTGGTGGAGAACGCACAACCTTTATAAACACAGCGCATCGGCCAGTCCGACATCAGCGGTGAAGAATACTCCGGAAAGCGA
AAGTTCGTCGCCTCGTTCGAGCATTAAGAAGATCCGAAAGCTGAAGCGCGAGTTCGGAATGTCCCAAATTCGCACTCCGTACCTGGGCTTGTTCCGCTCC
GAACATTCGAAATGCCCGATTAAGCGGCATGTGCTCTCTGGTGAAATCCTTAAACGCATAATTCGCAGTAATCTTCGCGTGTGGCAAGCCCGGGTGAAGC
TACGAATGAATTTCCTCACGTATCGTAACAAATGCTTGAAGCTCTACTGCTGGATGGCGTTGTTCTTGTATCCATCCGTATCCAAGACGATACTGACTAT
CTACAATTGCCAGGAGGTTGGCGACGTCTTTTACCTCGTGGTCGATCGTCGACTGGTGTGCTACAACGGACAATGGGCGATATTTGGGGTGGTTGCGACG
ATTGGAGTCATCGTGTGGGTCGTGGGGATTCCACTTTTCTTCGGCCTTTTAATCTGGCTAGCACAAGACCGTGGTGTTGCTGCCCGTGTCAAGATGCTAG
GAGAGCCTTATATGCTTCCACAACGTAAAAAATGGTTAAAGGAAGTGAAAGAGCAGCATATTGCAGATAAACGGTTTGTTCGCGATATGGACAGCAGAGA
AGTGGAAAACGAAGAACTGGCGAAATACATGAAGCGGAAGAATTTGAGGGTATGGCACCCGTTTGTGAATGAACGTTGAAGAATATGGCACCTTAACGTA
ACTGTTTTCATTCTGATACAGGACTCCACGGTTCAAGCTCGACTGGGTTTCATCTACGCTGAATGTAGGAACGAGCCAAAGCTCAAATTCTACAGTTGCT
CATGACCGAATATGTTTGCTATTTTTTCCTTCAGATACGGATGACTACTGGTGGTTTGAAGCTGTGGATCTTTCACGAAAACTTTTTCTTAGTGGCGTGA
TCGTATTCGTCGAGAATGGAAGTGTGGAACAAGTTCTGCTTGCTCTCGGTGTTTGGTAAGTtttacttgaagtatttaTTTATTGTTTTCATCGCGGTTG
TGTTCTAACCTATTTTTTAAAGCTTGGTGACGATGTGGTTTCTGCTCTACTTTCAACCCTACGATGGCTACTCGGATAATCTCATTGCTAGTATCACCCA
ACTGCAGCTGTATTTCACTCTGTGGCTCGGTGTTATGATCCGACTAAACGACCTCAATGTCGAGTCACTCATTAACGTGCAGCTGCTGAGCTATCTACTC
GTCGGATCTTGCATTGCGGTCACGGCATTCGGGTTTAAATTGATTTTAAGTGAAGGCCTCGCAGAGTCAAGGCGAGTTTACACCGAGGCAGTGGCACAGC
GCAAGGAAAGACTCCGGTTTGAGATTCGCAAGCGATGGTTCCAGGCGATTGACTACGGCTTCTACGAGGCATACATGGGACGACGCTACGGCGGGAAGCC
GAGTTTCATCCATCTCAGCGCCGCTATGCGAGGAGCTTCCCACCAAGCAAAACTAcgcgagaaagaagaaaaagaaggagCTTTGCCTAAAAGAGAGGAG
TGAAGCAGACGTGAATGCACCGAAGGCATTTTGCGTAGTACTTTAGACCTGACATTGGCAGTGGTTTAGAGACCAGCGTAAGCGTAACCTAAAGAGTCTA
CCTGCAGGTTTTACATGTAAAAACAACCTGTGAATATATGTGCATAGTTAGTATATTGATGGCCCACTACTTCCAAGTCATTCAAACCCCCTTGAGTTTC
TTTTATCGAAGCAGTGACGCGTCCTAGCGCCGTGAGTTCGGTTGGTTGGACGATGGGCCTCCCCCCATGCCGTAATTGCAGATTTGGCACTCCTGTGTTC
TCCAGTGGTATGCTCCGTTAATTACATCGAAGCCCACTGCGAATTCAGCACAATACCGGTCGTACAGGGCTTCCCACTCGCTAAACGTTACGATCTCGTA
TTGACGAGCAGGTGTGGAGCCAAGCCTGCACAGAAGACAAGCAACAAAGTGAGTATCAATCACACACTTCACGTTGCTAGAACGGCAGCTAACACTTACG
CTTGGGTAGCTTTGAGTGACTGCTCGAGGGAGAATCCGGAGAGGAACATCGAGATATACGGCGGCACGATCGTTCTCTGATGCGACAAGCAAACAAGCTC
GGCATTGAGAACTGGTCCAGGAGCGTCATCTCCCTGGCTGCGAACAAACTTCCTCCACTTGTTGAGCCACTTCTTGGGCACCAAAAAGTACGTGGCGTAC
TTGCTCCTTCCGTTCACCGACAAATGCGGGGCCAGTTGCTGTTGTCTGCTGCCGTGGGACTCCGTTGGTGAGAATAAACCTTTCGGGAACCCGTTCTTCC
TCTGtagcagttccagcagctgctccgAGCCTGCGATCTCCCCATCGAGCCTCgccctcttcttctcctccgcctccagctctcTGGCCTCCTGTTCCAG
AACACAAGAGGTGCAGTCGACGCACGAGCTTAAACTGAAGCCTCTCAGCTCGGGCGCGTACACTGCGATCTCCCTGAACACGTCCCCACTGATGATTGCG
CGTCGACGGCGACCCACACATTGAGTGGCAGGCAGCAGAGCTCCATGGGCGCAGACGATCATAGCTCCAGCCTCTGTCAACGAAGAGCTTGGTGCAATTC
GCAGTGTCTCTAACGGACTACTGTCCTTCCGTTTGACGGATTGCTGTCGTCTTTGCTGTCTCTTTGAGCGGcggaactgcagcaagaactgCTCCAGGGC
CTGGCAGCGCTTCCGGTAGCTCCCAAGCCACGCGCGACTCACGACGACGCACGAGGGAGCGCACAGTGCCGCATCTTCGAAGGAGCGTGCGTCGCAGTGG
gacagaagctccttcaggTGCAGCATCTCGGCGCCGTGAAGCACGGCGAGCGAGCGTGGCCAATGGTCGGATGTGGCTGGGAGGAAGCTCGTCACGGCGC
CAAAACGCCTAGTGATGACGCGCTCGAGCGCATGCTGAACGCAAGGCGTAGTCGCATCTAGCGAGCGGCAGGTGGAGGTCACTTGCAGCACGTCTCGCgc
cgagagcagcgagaagaggTGCGCCAACAGACCGTCCGGGAGGTGCTCCATTACGATAGCTTTGTGATGCAAATATCTGGAATAGATTTTAGAAGTTCTA
AATGAAATCAAAAGGCTAAATAACCTCCCGGTAAAAATATTGGCCGTTTGTACCCATGTGCGAAACGACAGTGATTAGTGGGAAATAAAATGACggattt
cagccaatgaacGGTGTTCACCagtggtcattctcagactcagagcgatttaaAACAACCAAGAAAAAAAACCAGCTATTAGATGTAAAACAGACTTTTT
ACAGCTAAATCGGTGATGATTTAAGGTTGGTCACaggtggtcattctcagatattatcagactcagacgTTATTTTCTTCATCCCTGTACTGGTTTTGAC
AATAAATGATACACTCTACATCAATTATTGTATTTTAGTTGAGAAAATGTTAgcaagctcttcgacgcAGTTAGCTCGTGTTGCTGACCGCTCTCCTGTA
CTTCTACCTCTTGCGTCTACTAGCAACGATGCGCCTCGTCATACCGTCGTTAAGCTTCGAccaacgctgctgcattaCCTGGTTAACAGTCGCTTACAGG
TGAGTTGAGACCCCAGCTCGGATTCCATGACTTCATACTGTTCTGACCAATTCTTTGTCAGTGTGTAATTAGATCCAAGGTGCCAATTACCGACGCAGCA
GAACACAGTAACAACCGCGCTGAAACTGGTTTGCAACTCCTGGTCTCCACTGCAGATGGGAACGTGTGGGTCGTCACGTTGCCTGGCCACTTGCAGCCTG
GAGCAGGAGTCGTGACCCGTGAGTTGCTGTTGGAACGCCAGCCCGGTAACAGTAATGATGGCTCGGTGCAGTGGTTCTGCCAGCTTCCTGGCGTGCAGTC
GGTGCATTATACAGCAGCAGGGTCGGGGCTGACGACGCTCACGCTGATGAGAAGCTTGATAACTCCAACCACTTTGATCGTGAGTATCCGCGGCAGTCCA
AGCTCGAAATTGCAGCGGCACcagtcgctggagcttgatGGGATCGAAGGCGAACAGTCTACGTGTGCATTTTGTCTCAGTAGTCAGATGGAGAATCATA
CTGGGCTGCTCAAGAGCTTGTTTCCGGATGTGGAGAAATATGCCGGTGTAGCAGCTATTTTACAAGGAGATCTGGATGGCTGTGTGCGGTTTTCGTTGGT
GCATTATCCGGCACCGAAGGGGGATATCGCGAAGGCTTCAGTGGTCCGCAGTGGGACGCTCCTTCGGCTGGGAGAACCAGTTCAAATGATCGTTCCGTTC
ACGACTGTTGATCCCTCGGAACCAGATAATGAGGCAGCAGTACGGCAATTATTTGATGCGCTGCTTATCGTTGGTACTCGAGGCAGGGTCGTGGTTGTTG
ACTTGAAGAACGGTTGCTCAACGGAGCCTCTCCCTGTGTCACTAAAGATGGAGCTTGGACGTGCAGTACAGTCCTTGGCGTTCGTAAACAGCTTGGCAGC
ATTCATTTTCTGCTCGAGTGGGATGGCGTTCGTGTGTCGGGTCACAGATCTTCTTGCAAAAGCCCAATTCGCTGGTGCAGATGCTAATGTTTCCTTCGGC
AATGACTCAAGTATTTCTGCAGAGAAGCTACCTCTTCAACCGGTACGTAGCATCGACTTTTAAACACCAGGCCCAATAGTGTGCTAATTTCTCTAAAATG
TCAGGGGATCATTCGTTTGGCAACCCATGACGGATCCCGCTGGATGTCGATTTTATTTGCCTCTGGGCGAATCACAACTATTGACGAATCTGTGCTTCAC
ACGATGGTGGCTAGTGTTATGCCAGTATCTGGGCCGGAACGAAGCCCAGCAGAGGATCTGTCCATTGAAAACCCAATGCAAGAGACTCGGGTTCGCAACC
TTTTGCAGCGTATTGCACAGGTTTCCACTAAGTCAAGTGCCCTACGGACCCAATCGAAGGAAATGGATTATCATCTCAAGAATTTACACTCTGCTTTGGA
AATACTTCGGCAAGTAGAAGCTTCAGGTGTGTGTAGCAGATCAGTTGCTGCTAGTGTGTGACCGTCTCATCAGTTCCTTGACTTCCTCAGGTGTGGGGTC
CGTGGTCAAGTGCGAATTGAGAGCTTCAATGGCAATAGCTGGGCCCTTCTCGAATCGACAGACGGTCAAATTGCTGTGTTCCTTACGTTTTGTGAACCCA
GAAGCTATCATCTCACTCGATGACTGGTGCGTTGGTAGTTGCAATTCGTTCATTTGGTCCTCTTTCGAACGTTCCTTATGAATCCTAACGGTTCTCTatg
gtgtacatgtaggttGCTGTGTCTGTACGTACGCACTCGCCAACAAACAGTTACGACGTATTCGTTTCCGCTGGAGGATGTAGCAACACGAAAAGAACAG
ATCGTCATCCTTGACCCAGACACACTCACTCAGCAAGACCAAGGAGTGTTATGGGTATCGTGCTCGATGGTATTTTATCCTTCGACGAAGggagaccaag
aagacaaaCACGGTGAAGCAAAACATGTTgcgttggagctgaagcCGACGCCTCTTGAAGATCCACTGTCATTGACGATCCCGTTGCTTCAAGACCGAAG
GTTTCTACTTGCACAACTGAGCCAGCTGATAGAAGAAGAGATACCAGTGAGTCAAGTTGCCGTTCACGCTGCATTTCGTCAAAACCACGATCCGGTCATG
TCAATCAGCAGAGCGAACTCTGATGGGAAGGAAGCATCTTCGCTTTGGGCTGGTGGGCAGTGGTGGGCAGCACTAGCTGACCATGCACACAAGAACCCAT
CTTTTGCAGCTTTGTGGGCCAAAATTATGCcggcagatgcagcacctCTGCCATTATCTCCCCCATCGCGATTCATACTATCCATacccttcttcttcgc
cgcagaagacgaatacgacgatgacgaagaagaagacaacgaAAAAGTTCGcgtcgagaagatgctgttGTTTCTGCGCCAAATCCTGGAAATTCCCGCT
GACAAGATCCCGCGACTTCGTCGTTGTTGTCGTACGCAGAATGGGAAGTTATGGACTGTACTACGGGCCTTTTCGGGGAGCCTCATTCTGCTGCGCTTCG
CTCCATCAGAAGATCAGCAGCGATCCGTTGATCTCACTATCCAGTGCTCCGACGTGGCAGATCTGTCAGCGGTACGTAACTTGGGGGATGAAATATTCCT
GATCGTTTTAACACTAACGAGAGCCCCGTACAGATGCGAGCGCTTGTATTGGACGCGATTAACAACTGGAGCGGTCTGGATCCTCCAGGAATTAGCGATG
GAGAACGTTCTGAAGATCTAGCGCTGGATATGGACGAAGTATTAGAGCCTATTGTCGCTCTCGAAAAACTTCTGGAGGTTCGTAGAATAATTTTTGGCTT
GTGCTATACTGGAGCTGTCAGTAAATTGTGTGCATCGCTTTGATTCATAggagctgaagttgacgaCTAAAAGAATTGAGAACCCCGACTCGGACGCTTG
TACCGATGAAGTGCTGCATGCACTGTCCCGGTTGGCCCACCTAGAGACTCAAACACTTACACTTTACTGGAAGACAAGAGTGCAACTCAACAGGACCATC
ATGTAGAAGGGGGCGAAAACGAAAATGTCACTATCCAGTGCTTCGAAGTAGGTAGTATCTACACCTTCGTACGGACCGTTTGAAACTACTTGCAGGCATT
GCCTGGCAGGCAAATTATCTTGTTGAGTGGCTCAGAGTTCTTCAGTGGGGAGATGCTGATCACGCAACGACGCCTTCTCAGACGGTGATGACACCGAGTA
CAGGCGCTACGAGTGGAAGGAAACACAATTTGTTAATCACAGCTCTGTATCTCTCGCTACTGCAGCGTACCTCAAAGTCTCGTGGTGCCCGAGTTGGCCA
AAGCATATAAATGAGGGCCAAATAGATAAAGCAATGCAACGACGTCGTTATAGCAGCTACCGTCTTCTCTCGCACCCatggcgacaagaaggatgCGATG
AGCACGATGACAGGCAGCGCTACAAAAAACAACGAGAACAAGCAACACATCTGGGAACCAAAGAGTGAGCACTTAAAAAAATACATTTGGCAACTAGCGT
CAGCTCGAGCACTTACTCGTAGGAAGAAGTGCCGTTTCGTCGAGGCTTTCTCGTACGAACGCGTCTCCAGTATTGTGTTGATGAACCACCCGAGCACGCA
CATCTGCAGTAGGCAGATACCCAGACCTGGCCACGAGTCGTAGATGTACAGTGTAGACGCCGGATCAAGCCACACTAGATACCACATCGCCATCGATAAG
TAAAGCACGAGAATGGCCAGTATGACGCACGAAAGCTGGATCTGGCCGTCCAGGGCAGCGCTGTTGATCGTCCATCCTTTCGCGATCACCATGGCAAGTA
GTAGTGTGCCCACACGGACGAAAACTTCGGTGATATTGGCTGCGTACTTGAAAAACGGCACTCCCACACCGTTGGACTGGTGCGTGGTGAAGTGGATGCA
GAGCAAGGCATTGCACAGGAAGAAAAACACCACAACCAGCGTAAGGATCCTCATGACTGGGTGGAACGACTCGCTCCTTGTCATGCCCCGTACTGCCACA
AGTTGTGccaccgctgcagctcccgcCAGTGCCGTCGTGACGGCATATATCGTCGGCAtcccttgctgctggacaggGAGTTCGCTCCCATCCGCCTGGG
TCATGTGGATATTGAACCATGACGAGAAGTAGTATTTGCGGAAATTGGTTTCCGTGATCTCCGCAAATGAAGGTTTGTACTGGTCTCCCCCTGGGACGCA
ACgcgccagcgccacgtaCCAGAACCTCGGTCGTAGGTGTTCGTGGATGTCTACGTTGAAGGTGAACGGGGTCACGTGGTGGTTGTTGATTGCGGTCACG
TTGAAGACAGCTTTGGTGTGCTGGGCCGAGACTTTGCAGTTGCAGTCGCAGGAACTGTCCGTCATGACGTAGTTCCAGAAGAGCGCCTCGTCGTCATAGA
CAGCCACCTGCAGTCCGTCTACATCCGTCTCGATTTCACCTGTGATGCGCTGGCGGATACAGTCAAATGGTCAGTTTGAGCATTGTCATGGTGGAAATTC
GTTCACGAACCCCCGCGATTTCGTCCAGCGTGGGCGTCCACgtgaagcagaacttgcCGATGTACTGGAACTGCCGCCCCACAGTGTAGCCTGTGTAGAT
GCTTGCTTGCGCCACGGACAGCAGAGCCACAAAGCTCAACAGTATTAGCAGGAATCGCATCGTGGTCTGGGAATCTGGGAACGTCGCGATCTTCTAAGGC
AAccaacttcaagaaggcAAATGATTGGCTGATGAATTTATGGCTACATTTTTATGGATGTTTTGGTGCAtttttctttcttttctCGACGAGATTGGTT
TTACAAGTGCGGTTTTGTCTTGTGCTCGTACGTCTCGGTGTCAGAAGAGCATTCGTTCGCGATGCAATGCATTACACTTGCTAGCGTCACTTCACCAAGA
AGTCAAGAATCTGAGGCGATTTCTGGCTGGGGGCACAGATCGTCAGTGCCAGCGGATATTCTCAAGGCAGTTGGATTTCGGTACAGCAACTAGCGACTGG
ACTTGGGTTCGCTCGGGGTGGCTTGGGAGTTATCGCTGGTGTTTTTGTGGTGGTGAGTGACGGTAGTATCCAGTTGCAAGTCGAGTTCTTGTTTACAGCC
CAGAGTTTTCCACTACACGTATTAATACAGGTATCAGTGGCGTGCCTCACCGTGAAGGCCGACCGCCACAATTGAGTCGCCGCGAGTTATACCATGCCAG
AACATGTAGTAACGGATGCCGACATGTGTTTAAATTTAAATGTAAAAATACTTGATCAAGCGGTTGTACTACAACTTGTAGAGGCCTCACTTCCCATGCA
GCGGCTTCCGCGAACAACATCGTGCACCCACTTGACACGTGCACTTCAAACTAAACAGCTTCCTGCTAGTGGGGCCGGATTCAGGCACAGATGTGCGTAT
TTAGTGACGCAAAATGTGCCATGTTGGCAAGCGAACACCCCGCAAACAAAAGGCGAAATTGCACCTTGTCGCCTTATCGTCGGTCTCAGGCGTCTTTCCC
ACCAGCTGGCGAGGAAACACTGTTTGCTCTCGACATGTTGGTTTTCGTATGGAAGGTACAGTAGAGACGCCTGGGTTAGGGAGCCCATAGTCTTTTCAAG
TCCTATTTGGCGTGCAAATTGTCACTTGACCATCACTTCGATTGGCAGCCGTTGGAGTCAGTTAGCTTTTTGTCAACGGTCCAGTATCAGCGTGTCTGGT
CGTGTGCAGCGGCGTTGGAGAAAGCAGTGCGGAAAATCTCCTGTGTGTTCCGTCGCGTGCCGAGAGGGAGTTCGAGCTTTGCCCGGAAGTCGCTCTATCG
CAAACTCGCGCGCTACTACGAGAGGCAACAGGAGTGTCAGGTGTCGAGGCTTGCGCCCCCCCCTCCCTCTTCGTCTTATCCAGTCTATTCGGACTTGTAG
CTAGACACAGGAACATCTAGCAGCTCGTACGGACGCGTCCGGGAGTGTTGGTCTCTCTGcatccttctccagcatgaCGGTGCGTCGCACGGAGGAGCTA
CAGGAgtggatctgcagcgtcacggcCTCATCCAACGATCATGGCGAGCACCTGTCGGTCATGCTACGCGATGGCCAGTTGCTCTGTCTCCTGGCGAACG
GCGTGGACCCGACGGCCAATCTTAAGGTGAACAAGCTCAACACAGTTTTCCACTCCAAGGCCAATATTCGCCTGTTCCTCGAGTGGTGCAAGAAGCAGGG
GCTGAACGAGGGCGAGATTTTCCAGCccgacgacctgctggacgCAGGGGCCGACTTTACGACAGTTTTGGAGACGCTCTCCATCCTCTTCGACAGGTTT
GGCACGATTGGCTACACTGGCGAATATGAGGAGGACCCCGTGTCAGATGCAGAGTCGATGACGTCCACCGGCAGTTCACAGGGACCGTCCCCcgtcaaga
aggcgcacagcaacaacaagctcaCAAGTTTCATGAAGGGTGGATTTTTatcgaggaagaaaaaatcgagcaagaaggtggtggacAAATCCCCACAGGG
GACGCCGCCATCTACTCCCCCGCCAGTGTCTCCGCAGGTGGACGGTGGAATGTTGTCACCGTCGGGCTCTCCGCCCTCGACACCGCTGGAACCGCCCCCA
CAGAAGGACACGAGGAGCAACAGTGGGGGTGCCAATGCAAATCGGCTGAACGCCTTCCTGAACCAGGTGCCGGCTTCCCACGGATCTCCGTTGACGCATG
TTGAGCGTCCATCTGGTCCGCCCAAGAAGACCAACTCAGTGAGGAAACCACCGGCACCTAAGCCGGCGCCCAAGCCGCAGCCTACTGTTAGGAGACCTCC
GTCGCCCAAGCAGCCTCCTAAGTCGATGCCGACCGGCGGGGATGCTCGCAATAAGTTCGCGGCCTTCATGAAATCCAACCCGCCGGCTGTCGAGACGACA
CATGGTTCAGGCCCTTACCAAGGGTCTGGTGGCTCGAACCTCTCTGCTTTCAAGTCGTCGGTCTCTCCCACTGCGGATTCTAAGCCGCCTTCCCCGCCCA
AGTCTGCACCTGTCCGGGGTCGCGGTACGTCAAGTGACCAGTTTGCACAGCGCAAGGCAGTGTTCGCTCAGGGCAACAGCAGCCCCAAGCCAGACATGCC
TGCCCCTGCTCCGTCAAAGCCGAAGGTTAACACAGGAGGGGGTACCAAACTGAACGACTTCATGAAGCACCAGCCGTCCGCTTCCCCTGCGTCATCGACG
AAGCCACGCTCCCAGAGCAAGTTGGCTGCTTTCCTCGCTACGACGAACTCGATTCCATCGATTGCGACGACGCCTTCCGCTGCTCCACCGAAACCGACCT
TCGGTTCGTTTAACCCGTCGAAAAACTCCCCGGCCGGCGGTCGATCAGCTCCGACGCCAGCGTTCAATGCAGCACCCGCTGCACCGATGCCTTTCAAACC
GCGCCACATGATTGAGCGTTCGACGGGCCGCGGTAACTACATCCGCAAGCGTCAGACGTACTGGGTGCCTCCTAAGCGCCGtcgcagcaacttcagcttg
gaaaagaagcgcaaggccttcatgaacgagcagctggaaattaaggaggagcagctccgacaacaagctgcaggtgctAGCAACAAACAGAACCTGATTG
TGCCGGGAGTGCAGTGCTACATTCCTGACAAGGAGGAagtgtggctgctgtccgaGATTGTGGACTACAATGACCGTCGAAAAGAGGTTACGATTACGGC
TTTTTTGGACTCAGGTAACTCGGAGCAGCGTGTTGTTGATCTCAAGAATCCGGAAATTAttcgtgctgttgctggacCAACGGCTACCGAGGTGGAATCG
CTGCCTGTTGCAATCCTTCACGACAACCCTGAGGGCGTGGAGGACATGCGTTTGCTTCGATACTTGAACGAACCTTCCATTCTGTTCAACTTAAAGCAGC
GTTTCACTGCATCAAAAccgtacacgtacacgaaTGACATCGTGATTGCAGTGAATCCGTACAAATGGATCGAGAACCTGTACGGTGACCACCTACACGA
GAAGTACCTGAAGAAGCCGCGTGATTCGCTTTCTCCTCACGTTTACTCGACATCAACGGCTGCCTACAAGCACATGAAGACTAACGAGATGAACCAAAGT
ATTCTCGTGAGTGGTGAGTCTGGCGCTGGTAAGACGGAAACTACCAAAATTGTGATGAACCACTTGGCCAGTGTGGCTGGTGGCCGCAAGGACAAGACGA
TCGCTAAGGTCATCGATGTGAACCCGCTTCTCGAGTCTTTCGGTAATGCCAAGACGACGCGTAACGACAACAGTTCGCGTTTCGGTAAGTTCACGCAGCT
GCAGTTTGACGGCCGAGGAAAACTGATTGGTGCCAAGTGCGAGACCTATCTGCTAGAGAAGTCGCGTGTGGTGTCGATTGCTGAAGGCGAACGCAACTAC
CACATTTTCTACCAGCTTCTGGCTGGCCTACCCAACCATGAGCGGAAGGAGTTTGGTCTTGACCCTGATTGCCAATATCAGTACGCTGGTTCCCTTGCAG
AGATGCAAATCCCTGGCCTAGATGATGCCAAGTGGTTTGCTAGCACGCAGAAGTCGCTGTCCATCATTGGTCTGGATAGCAGCGCGCAAAAGACGCTCTT
CAAGATTCTGGCTGGTGTTCTCTTGCTTGGCGAGGTCATGTTTGACAAGAGTGGCGAAAACGGATCCCGCATTTCGAGCGGCTCGGCTCTGTCACAGGTC
GCGAAGATGTTCGGACTGCCCACGACGAGAATCGAGGAAGCTCTATGCAACCGTACGGTGATCACTCGTAACGACAGTGTGACGGTGCCACTTGCTCCGG
TTGAAGCGGCCGAGAACCGTGATGCGTTAGCAAAGACCATTTACTCCAAGATGTTTGACTGGATGGTGGTGAGAATCAACGAGGCTATCAGTACGGACGA
GAGCCGTATCAAGGGCCAAATCGGTGTGCTGGATATCTTCGGCTTTGAGGACTTTGTTCACAACGGCTTTGAGCAGTTCTGCATCAACTACGCGAACgag
aagttgcagcagaagttcacTACCGACGTCTTCAAGACTGTCGAGGACGAGTACATCCGTGAAGGTCTGCAGTGGGATCACATTCAGTACCAGGACAACC
AGGGTATCGTGGAGGTGATTGAAGGTAAGATGGGTATCATCGCCTTGATGAACGACCACCTGCGTCAGCCGCGTGATACCGAGGAGGCTCTAGTGAACAA
GATCCGCACAAACCACCAGACGAAAAAGAACGGTGTGGTAAACGAAAGCATCGACTTCCCTAAAGTCAAGCGCACGCAGTTCATCGTCAACCACTACGCT
GGCTCCGTCACTTACGAGACGGTGGGTTTCATGGAGAAACATCGCGACACGCTGCAGAAGGATCTGCTGGACTTGATTCAGCTCAGCAGCCTGTCACTGC
TTCCGGAGCTTTTCGTAGACAGCGAGGCTACGACGGAGGGTGGCAGCGGCCGTGGCAAGAAGGCTCCGAAGAGTCTCGGCTCTCAGTTCAAGACATCGCT
GGCACAGTTGATGGACAACATCAGAACTACCAATACGCATTACGTGCGCTGCATCAAACCGAACTCGAACAAGAGCCCGACGGAGTTCAACAAGCGTATG
ATCGTGGAGCAGTTGCGATCGGCCGGTGTGATCGAAGCCATTCGTATCACGCGTTCTGGCTACCCGAGTCGTCTGACCCCGAAGGAGCTAGCTACGCGTT
ATGCCATCATGTTCCCGCCGTCTATGCACAGCAAGGACGTCCGCCGTACGTGCAGCGTTTTCATGACGTCGATCGGCCGCAAGTCGCCTCTGGAGTACCA
GATGGGTAAGACGCTGATCTACTTCAAGAACGGTgtcatggaggagctggaagccaTGAAGTCCGACTTTATGTACTACGAGGCTCGCACTATCCAGCGT
ATCGTGCTGGGTTTCTTGGAGCGCCGTCGCCTGCGCAACAAGATCGGTGCTGCCATTGTCTTGCAGTCGTACGCCCGTATGTCGCTGGACTACAAGGAGT
ATCACTTCCAGCGTCGTGCGATTATCAAGATTCAGcgtggctggaggaggtACAAGGCTATTCCGGTTGAGCCCGAGTACAATTCAGAGGAGGAGTACAA
TGGCGGCGGCCAGTgggtggacgagatggacgaccTTGATGACTCGGATGCTGACGAGGGCTTCGGTGATGACCCCGCTTCGGTTCGTGCAGGACGTGGC
AGATCGATCGCGGACCGGATGGAGTCATTCAAGGTGGCTCACTCGGGTCGCCGTGGCAGCGTGAAGCGTCTGAACGAGCTTTCGCAACGcgccaagagct
tcatgaagacgcgcagtggcagcggcagcacttcgagctcgagcggcATCTCTCTGGAGGATGAGAACTCGATGCTCAAGATTGAGAACCGCAACCTGAA
GTACGATCTGGAACTGATGCGCGAGCAGTGCATCGAACTGCAGGCCATCATCCTGGAGATCAACAAGAGCCGCAAAAGGTGAagtgtgtgtgtgctgcGG
TGTTCCGGTCCTCGTTGCGTTCCCAGCCCTGAGCGCAGCCAGAGGACAACAGTTTTTTAAGTAAACGCCGCAAGGCGTATATCTGTAGCGAAAGACAAGA
ACAAATTTCTCTTGCAAACATGTGAAAACGTTGAGTAGTTTACATTTTAGTGTGTTGTTAGTTTCAGTCTTGACCTTGATCGCTGTAATTGTCGAGAATT
CGCGGGAGAGAACATTGCGAGCTGTATCACATCCGTCCATCAGCAGATGGATGCCTTTCCTTCGCTGTGAGTCACAGGGGACATGAAAAACGTTTTGTGT
GGCTTCCAGCATCATCCTCAAGGCTCGAGTTTttcgaagcagaagaggtGTCAGGGGGAGCGAGAGCTCGCGGCGCACTGCCGATAAGTCGGCGTAGATG
GCACTACTGATGCCCGACATCAATCTCCGCCGTGCTAAGCGCCACCTCGAGGTTCGTCTTGCGATGTACTTACTACTCACGTTTTCCATCCATCCGAGTT
TTGATGTTGTTGTTCTTGCCGTTGGCCGGTTATTGTCGCCCGTAGCGCTACTGGCGCCAATTGCTTGGCGGGGACCGACCAGGAGAACGCAGGCGCTTGA
TATTTCGATCCAAATCCGTTGCGAAGACTAATAAGactggccaagctgcagtgcATGAAAATGCCACCCCCACCACTGGGATCAGCTCCGTCGAGGTGGC
ACCACCAATTCAAAATCTAGAGCCTGACCCGGAAATGGAGGTCGACGACCAAGAGGTGGCTCGTGGTTCCGACAAGCGAGGTGTTGAACTTGATTGTGGG
TCGTCATCGGCGGTGCAACGCGCGAATTGTAACCAGGAAACGGAGACGAGAATTTATGGCTGCGGCAACGGGAAGGACGAGGAATATCGTCAAGAAGTGA
ATCAAGTGGCCactggtgaagctgctgctgcagtcgatgaGCCAGAGTGCAACGAATCTGCTACCACTGACGAATTTTCAAAGCTCGAGTCGCAGCAAGC
TCCGACATCGACGAGCACAACTggaacttcatcgtcgagatcCGCAACCTCCGTGTCATCGTCTCGAACTAAGTCCTTTAGCGTCAGCAAGCCGCCGCTA
TTTCGTGACAATAAGCACCTGAACAACATGCCACTACCAAAGGGCAATTCGCGAGCTCAAGGTCAGTTGCAGCATTTCATTTCCTCATTATGACAAATGT
TGTGTTGACTCATGGAGGTTGCAATGCATTAGGTCCGACGCTAGGTGCTATGTTGCAACGTATCCACCTGAACGACGGAGACGTGAGCGAGCTAGATTTC
TCAACGCTCGCGCAACGCAACAAGCGGCTGGGAGCTGAAGGGTGTGCTCTCGTGGCTCGTTCTTTGACGACTAACCACACAGTCCGGAAGCTCTTTATTC
GGGACCACGCTatcggagacgacggtgcGATCGCTCTCTCGAAGATGCTGTGCAACAACACAACTCTGGAGTACCTGGATCTGTACGGCAACAATATCGG
TGATCGAGGAGCTGAGGCACTGGCACAAGCCCTGTATGGACACGACTCGCTGAGGCATTTGTCTGTGAGGAGCAACTTGATATCGGATCGTGGGGCTGAG
GCTCTTGCTCAGGCCATTCGCTGCAACTGCACGATTAAGTCTCTCGAGCTTGTTCACAATCGGATATCAAAGGTCGGAGCACAggcactgctggaagctt
tAGACGTTAACAGTCacctggagacgctgaacttGGAGGCAAATCCTGTGCCGGAGTTTGTTGCGAGTCagcttgctgcagcgctggcacGCAATCGAGC
CGAGTCGTTGATTCTTGAGTCGCAAGCCGCAGAAAAAGAGGCAGTGAAAATAGTGCGGAGAGCTAGTGGCTTGGAAaccgaagaggaagatgacaGCAGT
AGTGATCaggatgatgatgatgaagactGGGAAGAGGACGACTGGGAAGATGATGACGGCGATAGCGTGTCGAGTGGTTTTTTAAGCTGCTCCGGCGTGA
CAGACATCCCGTTGAGTAGCAGTGGGTTATGGATTTAAAGAACCACTGGGAAAACATGATAATAAAACAAGTTGTAGAAGGCGGATGTGAAGTTACGTAC
TTTGAAGCAATCCCTAAATCGTTAAACCTGAGCCTCTCGATCAGCAAAAGAAGTTTGCCGTATCCTCCGGCATGTTGTCACCCAGTAATTCGTGGCACTC
GAGATCTGTCACCTTTGCATCCGCTCTGCCAACCAATATTTGATGGTCTGGTGCTTTGGACGGAGCCGTGGTTGGATACTGGTATCCCCACATTTCTCGG
TAACTTTCCTTGAACAGTTTGTTTAATTCCCAGTCGATTTTGTCTTCGGCAGGTAGAGCCTCATACAGCCCAAGATGTTTCAACGACTCGTCATACCACT
CATTCTTCGCCGTCAATGCTCCGAATGGCGAGAAAAACTTGTGGATTCGAGGTGATGTTTGTGCTTGTGGCGGGCATCTCACAAAATTCTTTGGCGTCAG
AAGTAAGCTTGGTTGGCATTTTACTGCTGTCCCTTGCGTTTCTTCGCTAGTAAGCTGCTCCCAGTTTGTCGCATCCCGAATTTTAGCACTGGGCATGGGA
GTAGCCGCGGGCGGAAATGTGGGCGATGCCATCAAAGCTGATGCAGCGTGAAGATTCTGCCAGTACGCTAGCGGTGGAGAAATCAACTGGTATTCCGAAG
ATCCTGACTGGGGACTGTTAAGACCACGCAAGCTTATCACTATGTCGTCAAACAGCGGCACGCTGTTTGTAGAGTCGTTCCGGTTCGTCGCGGGAGCAGG
GATAGCAAACAGCAACCGAGGGTTCGTGAAAATGTCGTAGTTGAAGCAGACGTGCTTTCGAAGACATTTGTCAACACATTTGGGGGAATGCACGAGCGAC
GTATCTATCATGTTGCAGCTCCCCAGCACAGACACTACGTCATATACACGGCGCTGCACGTCACTGTACGCCGCCACTGTCGTAGAACTCGGCGCCACTG
CGGAAGCTTTCTTTGCTTCAATAAGACGGTCGCTAATAGTAGACAATTCCACTCCAACGTGATCCTGTTGAAACATCAGACCCAAGAAGCAGACCGTCAT
CGTCACCAAGCACGGCCAGTTCTCAATTGTTGCCTGGTCCTCAAAGGTTTTCACGAGGGCTTTATCTTCATCCACAATGCTGCTTCTCATGGAGCGATGA
GACTGCCGAAAACTCATTACCGCTTGCGTCGCGTTGGCTTTCATGCATTCCAGATGCTGCACCACTGCAGCCTTGCCGTAGTACCGGAAATACGCTCCCT
TGGCGTTGCGTGCCTCATTGTATCGGGCACGTTTGATCACTCCAATGCCTGTAGCCGCAAGCGTTATGATAATTATCCCCCACCAAATTTGTGCAAATAA
TATaccttccagcacgtgcaaCACGTCGTAGATCCGCCGTTTCCTCGGCACTATGTAGCGAGCATCAGGACAGGTGCCATCCACTCGCGAAAAATGCACG
CCCTACCCTTCATCTTGTAGATTTCACTCGTTGGGACAAGGATCGGGAACACGGGGCCAGACACAGAGCGCTGCAGCCCCTCGTGCTCCTTGAAAAGCTG
CAACACTGTGAGCGttctgaaaaaaaaaaaaaactcagCATCAGTGGTccggcggtggtggtgctcacCTCATATTGAAACGTACATCTCTCCCAGGCTC
TTCGCTGTCGCGAATCGTTCTTGGATGCCATTGGCAATGGATGCTGGTAAGCTGTCCACAGGACTTGCACTCCAGTCTGACACTGACTTGACACGCTGAT
GGCGTTTGCGCCGCTTAATTGGCCGCTGGGAAGCTTGCTCCACTTTGACGGCTGCCTTTGGGGCGACGGCTTtggtggacgagaagcgcaacTTGCGTCG
GTGTGCGCGCTGGGCCTTCATACTTGCGTTCGATCCGGCAACTTCAAAAGTGAGAGGTTAGAAAGATATTCCACtgaagtgaccatcactctgttTCCGT
TTTGTTGAAGTGTGATGAAAGGCAACCTTCTTACCAAGGCACCCTGTCGCTTTAGACACTCGAGTCATTTCTTGACAGTTTATGTGACCTAATTTTGCCA
CAGCGCTGAATGTCATCTCCGTGTGGCATTTAGATGATCTAAATGCCACACAGAGATCTTTAGATGATCTAAATGCCACACGGAGATCACATTCGGCGAT
GTGGCAAAAATAGTTTTTTTCATCCGATTTTGTGGAAGCTCAGCGGTCGAGGAAGGCGAAACCCCCTCCTCTCATCTCAACATGTTTTTGCTGGACTATT
CCAAGCAGTTAGTGTGCCGCATTCCAGTCTTCTTGCTGTACTTTGCCCGGTGAAGCTACCACTAGGCGTTCCCTCTCACCTTCCTGCTTGTGTCTGGCTA
CAGCAGTTCGTGACAAAGTGACCCATGGGTGAAGGAACGGCGGGGAATGGCGGGAACTTCCGCGTGGTTCATTTAAACGATGCGCACCGCAATACCGAAA
CAGGCTactgcaacaacttcatTGTGACATCGAAGTATACGGTCGCGAGTTTCCTGCCCAAGTTCctcttcgagagcttccgcAAGCTCTCTAATCTCTA
CTTCCTCATCATTTGCATTTTGCAGTGCATCCCTCAAATCAGCAATACCAACGGAAACCCTTCGACGTTGCCACCTCTGCTGTTCATTATCACGGTGGAC
GGTGTGTTTGCAATTCTCGAAGACCACAAACGTCACCAAGCTGACAATATTGCCAACGCTAGCCCGACACTGGTTTTAGACCGCGAGACGAAGGCATTCA
AACAAGTTACGTGGGCTGATGTTGTCGTGGGAGATATCGTGAAAGTTGTAAACCGTGGACTGGTACCTACAGATATGCTTGTCATCGCGGTAAGCGAAAT
ACCGAATCAGCCACCGTGTGGCATTTGCTACGTGGAAACCAAGTCGTTGGATGGAGAGACCAACATGAAAGTTCGTTCGGCAATGGAATGTACGCTAGCA
GATATGGGCTCCATCGACAACTTGCTCAGGATGAAAGGTGTCATTCGGTGCGAGCACCCGAACAATGCGATCAACAGCTTCCAGGGTGTGTTGGAGCTCG
AGGGGAAGGAAAACGCCTCTATCCCATACGAAAGCATCATCCTGCGTGGTTGTATTATCCGCAATACTGAATGGGTGCAcggcatcgtcttcaacactgG
CAAAGATACGAAGATCATGATGAGTAACTCGGCACCTCCATCGAAAATGAGCTCGATGGACCGGTCTATCAACCAGTACACAGTCGTGTTGCTGTTAATC
TTGATCGTTTTTAGTGCTGTCGGTGCAACCGGTGCAGTGTCGTGGAAGTCGAACCACAGCTCCGTGTGGTATCTTGAGTTGGATGCGTCCGACAACAGCG
CATTCGTGGACTGGCTTATTATGCTGTTCTACTACCTGCTTCTCATGTACCAGTTTGTGCCTATTTCACTAGCTGTCTCCATGAGTATGGTTAAGTACCT
CCAAGCTCAATTTATCCAATGGGATGCCAACATTTACCACCCAGACACGGACACCCCGACACTGGTGCGCTCAATGTCACTCAATGAAGAGCTCGGACAG
ATTTCATATATATTTTCCGACAAGACTGGAACGCTTACCTGCAACGTCATGGAGTTCCGGAAATGTTCAATCGGTGGTGTATCATACGGCAATGGAACAA
CGGAAATCGGGTTGGCAGCTTTACGACGTGCTGGTAAACCTCTTCCAGACATGACTGCGCAATCTAAGGGCCCAAAGGTTCCTTACGTAAATTTCGATGG
GCCGGAATTATTCAACGATATGAAAGGAAACTCGGGGTCCGTGCAGCAAGGGCGAATCGATGCATTCTTCACGCATCTTGCAGTATGTCACACTGTTATT
CCTGAACGCCATGAGAATTCTACAGAAGTTACTCTCTCAGCTTCATCACCTGATGAGCAGGCTCTCGTGGCAGGAGCTGGGTATTTTGGTTACGAATTCG
TGAATCGATCACCTGGCATCGCGCACGTTAAAGTTCGAGGTACCGTCCAAAAGTATGAAATGTTGGACGTGCTGGAATTCAACAGTACACGAAAGCGAAT
GAGCACGATCATCCGTCATCCCAATGGCCGAATCTTCTTGTACTCAAAAGGAGCGGATGTGATCATTTACGGACTCTTAGTACAGGACAAAGAACATGAA
TCCACTTCATCCCTGCTCCAGGAGATTACCCGCCGCCACATCGATCAGTATGCAGAAGACGGCCTCCGCACACTTACGATTGCGGTCCGTGAAATCGAAC
CTTCGCACTACGCTGAATGGGCAACACGCTTCCACGACGCCCAGAACAACTTGAATGAAATCGACAAACGCAAGAAGGACCTGCCAAACGCGATTGATGA
ATGCATGAATGAGATTGAGTGCAACTTGGAGCTACTTGGAGCTACTGCAATCGAAGATAAACTCCAGTCTGGTGTCCCCGACGCGATCGCGAACTTGGCA
TGTGCCGGAATTAAAATCTGGGTGCTCACAGGCGATAAGGAAGAAACCGCTATTAACATCGGCTTCGCTTGCCAGCTCGTGACGAATGACATGAAACTGT
TCATCATTAATGCGAAAAATGCACCGACCCCGGAGATACTAGAAAGCACCTTGAGAGATGAGATTGGCGCTCGAGGTGCTGATGTCACCGTTTACCTGGC
TTCACCACCGGCTACTCGAGGTGAACTACGAGATCTAGCTCTTGTTATTGACGGTGAAACGCTGATGTATGCTCTGCGGGGTTCGATTCGCCCACTCCTG
GCAGAATTCTCTCAGTACTGTAAAGCTGTTATAGCGTGTCGTGTGTCTCCTGCGCAAAAAGCTGAGATGGTTGCATTGATCAAAGAGTACGTTCCTGGTG
TCCGTACCCTTGCTATCGGAGATGGCGCAAACGATGTATCCATGatccaagaagcgcacgtAGGAGTTGGCATATCAGGTCAGGAAGGTATGCAGGCTGT
GAATTCGAGTGACTACGCTATTGCCCAGTTTCGCTTCTTACAGCGGTTGTTGCTCGTTCATGGGCGGTGGAACTACCGACGCATGGCGCAGTTGGTGTTG
TATATTTTCTACAAGAACATTCTCTTCACCGCGGCTCAGTACTGGTACACACTTCTGTGTGGATTCTCGGGGCAGAAATTTTTCCTAGAGAGCGGCACGC
AGTTGTACAACATCGCACTCACGGCAATTCCAATCGTTGCGGCGTCAATCTTGGATCAAGACGTAAATGATGAAGTGGCCATGGCTTTCCCGAAGCTATA
TTTCACAGGGCCACGCGACGAAGACATCAACACCCGTATTTTCTCGCTCTGGGTCATTGGTGCAATTGCCGAAAGTATTATTATCACATTCCTTACGATG
TACAGCTTGCAGGCTGCTGGATTTGCAGGAGGGAGCCCCACAATGTGGCTGGAGGGCTTCATCGTATTCACTTTGGTTGTGTCGATTGCCAATGCCAAGC
TATTCATGTTCCAGAACAGCTTTTATTTCTTCAACTACTTCCTGTACTTCGGTTCCCTTGTCATGTGGCTCGTGGTTGCGCTGGTGTGCAGTCACGTCGA
TTTCCTTGCTGATCTCACATGGGAACTCATGATAGAGCATGCGTTCGGCCTTACGTCCTTTTGGTTAATCTGGTTGTTCGTCCCAGTGGCTGCACTGTCG
TACGCGCATCTGCTCAATGGTGTAAGATCCACTTTTTTCCCTGAATATTGGCAACTGGCCAAGGAGGTCATTAAATTCAATCTCGATCGCAAGCTCCTGC
AGTGGAATGACAACAGCAACGCGTCTGTGGCGGTACCAGCTCGGCTTCCTCATGCTATAAGGGTCGCTAAGAAAAGTGGCTCGGTCATCCCCACCGatgg
ccgacagcagcagcaccggaCAACGGTGCAAAAGGCGTATCATGGGTTTGCCTTCTCCAAAGACGGTTATGCAGGGGCCACAGAGACTCGATTGCTCATG
AGTCGCAGCTCCATCACAAGTGTAACGTGAATAAATGAGTGCGAAGGTTAGGCCCTAGTTGAATTTTCACGAATACACAAAACT