Description :
From Genome Similarity Track
Location :
Scaffold_1204:436- 4955
Transcript NameFunction/comments
Phymu_g12920hypothetical protein PHYSODRAFT_354328
Phymu_g12921conserved hypothetical protein

Sequence
4519 bases(100 bases per row)
ACTTGCCAGTGCGGCGCGACTGGCAAAAGCGTGTTGACCTACGCTAGTAATCGCACGGGTCGCATCAACAACTTTGGTGTACGGTGCGAAAAGACTCATC
CTCTGCACCGCCTTCCTCCTCAAAAGTATTCGCTCTCATGGCTAAAATATATGTAAAACGTTAAGTAATTTGTACCTATGGTAGCGACTTTATTGGATGA
CTGTACTCCATCTGTCACTGCTTGACGGACGCCATTGTAGATTTCCACCTCGAGACCGCCAAGACGCCCATGCAGGCCGTACTGGGCTTCCTCGTGGTGT
TGGCCATcatcgcgctgctcttcttcttcctgtcgaTGCTGGCCAGACGCGCGTACATGCGCCGCCAGcggtcgctggagctgcacgcgccTCTGCTCAA
GTGCGCCACACGTCACAGACTTTCACTGAACTTTTTGCATTAAAAAAATACCAAcattttattttattttactgcagctcggacgacCGTCGCCTTGATG
CAGCACTGAGAGACGCCGAGGAAGGATTCAACGTGTgcgcagtctgcagcttcgagaacttcaagcgcttcaagttCTGCACAGTCTGCGGAGAGGCCAT
CGTGAGTGGCGAGGAGAACGCAGATACTAGCAAGAAACGAGCGACAAAGCTGTCGTTCTTGCCGCTATTCAAGCGAGAAAAGAGTAGAGTGGAGCTGGTC
ACACCCTCTCCGCCTAAGAAATCCACTCGTCGACGCCTACGAGCGGAACGAAGGAAGGAATGGACGAGGAAAGTGGACGTGGAAGGCCGGGTCTACTGGT
TCAGAGATGGCAGATATGGAGACACGCAGTTTACTGGATTCGTTGTCAAGTTTCTGTCTGCAAATGTGTCAGATACAGATACGAATTCGACTTTAATTCA
ACACGATGAGGGAACTTCAAAAGGAGAACCGTCGTCCAAAGCAGAGGGGGCTTCCGAACCTACACCACAGCCGTCTGGTTGTGACTCTACTGCGTCAGTG
GACGGAATCACTACGTCCTCTGTTGGAACAAACATTCCCGAGCCGGAACCAGAGCAAGAGAACAGTGGGAACGAaaatgctggtgctgttgaGCAAGATA
GTGCCCAACAACCTGTGGTCGGATCGGTAGAAGATTGCATTACCACCTTAGTACGGTACACCCAAGATCAGCACGTTATGCTTGCGCCGTCGTCTGACCA
AGCTGTGGATGcctcgaagctgccactTGACATTGGCATTGGTGCAAATGGTCAAAGTTGCACACCTCTTACGGAGACACTGACACTTGCTGCAAAAGAT
TTCCCATCCAAGTACGCCCATTTTGTCACTGCAACGTCAGCGCTGCTTGTTCCTGCGGAGAGGGAGCACTTGCGGCTCAATGTAGAGCGTGCCAATGTGT
TTGAAGACTCGATGGAGTCGTTGGCGATCATCCCCCTCGAGAATGCCCACTCAGTACTCCGCATCAACTTCTTGGACGAGAGCGGagtcgatgctggtgg
atTGCATCGTGAGTGGTTTGTGCTGCTGAATGAAATGCTTGTGGACCCTGTACGGATGCTGTTTGTGTGCACCAACAAGAGTGAGCAGACCTACTTCCTG
AGTCCGTGCTCGAATGCGGATTTTTTGCCGGATCAATTGCTGCATCTGTATGCAGCTGGCCGTCTACTGGGCCGTGCGCTGCTCGAAGGATCCATGCTGT
GTTTTCATCTTGCGCCGCCCTTGCTAAAGCTGATACTAGGCCACCCGCTCTGCTTTGCAGACGTGGAAGACTTCGACCCAGAAGTGTATACGAATCTGCG
TTGGCTACTCGACAATGACAATGTCGAGTCACTTGGCCTCTACTTCACTGTGACTGTGAAGAACGGCAACAAATACTGTGATGTCGAACTTGTCCCCGGT
GGAAGCTCACTGGCCGTCGTCGACACAAACAAGCGAGAGTATGTGGAGCGGAAGTGGCAGTATATGCTGGTGGAAAGTGTGGCACCTCAATTGCAAGTAT
TTCTCCGTGGTCTGTATGAAATCGTCCCtcgcgagctgctgctcctttTCGACCCCGAGGAGTTTGACTTCCTGTTGTGCGGGtccgacgagatcgacgt
cGATGACTGGGAGCGCAACACCAAGTACTCGGAAGATCTGCACCATCACCGTTCGCTGCTTTGGTTCTGGGAGCTCGTGCGCGAGATGCCGAACGAGTAC
CGTCGACGATTGCTTCAGTTTTCCACCGGTTCATCGCGCGTGCCCTTGGGCGGATTTAGTGCCTTGACGAGCTACGACGGTCGCTTATGCCCATTTACAC
TGAAAGCTGTGTCGCTTGTTGGTGACGGGTTCATTCATAGTCACGCTTGCTTCAACCGGCTCGATCTCCCACTTCATGTTGTGCGGGACGAGCTAAAGGC
GGTGCTCTACGCGGTGCTTGAAACGGAGGCGTACGGATTCACAACGGATTGAAGCGTTAACTGTCATTATTCGGTGCGCGCGAGTATTAATACAGAAGTA
CTTACCATGAGTCTGCTCGATAAATGGATGCAGGCGGCAGGAGACAATAATCTTGAGCTTGTCATAAGCTTGTACAGCGATAATCCGGGTCTGCTGGACC
AGCGACACCCTCACAGTGGCCGcacagcactgcaacatgcGTCTGCTTGGAATGCTCCCGACGTCCTGggctttcttctccagtaaGTACTTCAGGAAGC
AGTTCTGGTTCGGTGGAAATTGAAGTAAATTTCTGCTTGTAGacatggcgctggcgttctcGTGACGGATCCCGATGGGAACTCAATCCTGCAtcttgca
gcagccaacgcacTAAGCTCGTTGCAACTCATATTGCGACACCTTCGTCAATCATCGAACCTGGATCAAAACTGGACACGATCGCTCTTTAATCAGCGCA
ACCGCTTCGGATACACTGCCCTGCTGATCGCTGCCGAAGAAGGATTCGCTGACTGCTGTCAAGCGCTAGTCAGTGAGGACGGCGTCGACTCAACACTTCC
ACTTCCGGAGGCACCCCACCCAACTGCAACAGACTTAGCTCTGCGTAATGGTCATCTCCTAGTTGCCGAAGTTTTACGTCGCCACGCCAGTGCCGGTTAA
CGTTGGGGATTTAGACTCATGTTGAAGTAAATCTGTTGCAAATGAGGCTCCAGCTTTGTCAGGGCCGGCTTGAGTACTTCCTCCACTCCTTCAGTCTGTA
AGACCAAAGTTCCAACACGCTCAGCAAACTCGTGTTCCCCTGTAGCCAAACGAAAGCGTTAATTTCACGATTCCACACGCAGCAAGGCACCTCCAATCGT
ACATGGTCGTAGGAAGCCCGTCTTGAACAGTTCGGAAATGTAAACGTTCGCAAGAGCTTCTGACTTACTTGACAACATGGCTGCCAACCAAGGCTGGAAC
GTCCAGAATCTGATGGGTTTACGCACCACCCAGTCGCTTACGATTTTCTTGAGATCCCCAACCATCCCTCGAAGTTGCAGAGGTTCCTCCTTGGGCCATT
CGCACATGACAAGCATCAACACTACGACCTCCTGCAGAGATTTCATGCATTATCAGTAAAAGACTGGAAAACCCTTCATCACAGTAGCTTACCCGGACAT
CTTTACCCTCAGGAGTCTCAAAGCAGTCCCGCAGATCTTCCAGAAAGCGGCGATATGTGTCAgaatcagctgcagctcgagcatCCACTGCGTTCCGTTG
CAACGTCTTGGCCATAGCTTTCAGCTGAAGCGTGCGAGGTGACAGAGAATAACTCTTGAGTGGAGACACCATGATCCATCCAGAAAGCACTACAGTCACA
GTCAGTCTGCTATTTGCACCAACTACACCTGAACAAACGTACCTTGCACACGAACAGGCTTGCACCTCTCGCTCATTCGTCCAGCAATCGCCATCAGAGC
ATCCGTCCGCGGTGTTTCGACGATACCTTCAATCAGCAAAGCGCTAATACCCAAGCACAAGTCTCACATATCAATACCCTCGCTCGATCCACCTTGAAAC
CACATACCTATGGGGTGTATTATCTTCCCGTTCATCAAGCAACTGGTAGGAAGTGTCCTCATGCCGGTTtttcagctcctgcagcaccgcaaCCAGCAGT
TCCGATCGCGTTGGATGTGACGCTAAGAACGGGCTCTTTAGGATCGATCGCAGCAAATGGACCCTTGCTAAGCGCAATGCGTCTGCTGTTAGAGCTCCGT
CTAGAGGCAGCGTTGGCAGCGTAGCGACTGGGAACCACTGACGGATGCGCGTCTCAATGTCCTGCTGCGAGTCACCACCAACTGCGTCTTCCGCAGCGCT
GGCCCACTGCAAAGCCCTCTCGAGAGACTCGATGTTCCACTCGTGCAGCTGCGACGTATGCGTGAGgttcgccagcttcacgaACGTGCGCACCTGTTCA
ATAACCTTTGCGTCCATTGCCGAAAGGCATTTAAAATAACAAATGCCTTTATTTATTGAAAAACTTTTTTAGAAGCCCTTAATAAGGACCTAAAGAGCCT
TCTAGCAACAAATGCCTTT