Description :
From Genome Similarity Track
Location :
Scaffold_2389:436- 2158
Sequence
1722 bases(100 bases per row)
GCGGCACTGGCCAAACTATCCGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCAACCAACCCACGCAGGTGGATCATCACTTTCTGC
CGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATTACCAAATTTGAATCCCCACAAATCACCAGCCGTTTTGGATCTT
GTCCCTTTAGTAAATCCAAACCCAGAAGGAGTCCGTTATACTCCGCTTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCA
TCCGGGCAATCTCCACAGTATTGCACTGTATGCTCCTCCTCCGCGTCGTACACGAGCGGATCCATCGAAACTCAGGACGTATAGATCCTCATCCACCTGT
ACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGGGCGATCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGG
CCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGCGTCCAAGGTGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGCAA
CCCGGCCGACTTGAACAGCCAGGCTAGCGTGGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACTAGCAGGTTATAATTTAGATCCAACACGCGCAGG
AGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAATGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTT
GTACCAGAGCCGCTGAGACCGCCCAGTCACTGGCATAAACTATCACCGTAGGTTGACGTTCCGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCT
GTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCAGACCCGTCGTCTCTATCCAGACTGGATCCTCTCTC
CGTTGGTCCCGGGGTGGATGCAGCTCCTGTTTTAGGTCCTCTTCTGGCGTCGTACCACTTGGATCCCTTCATGGATCCGACATCTCCCGGGCCAGAGCTT
GTTGGATTTTGATCCGGACGGCTGGAGTGGTCATCGCAGCAAAATCTATCTCTCTCAATTCATACAGTACCGCGACAATCAGGGCGTAATCCTCGATGAA
CCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGCAACGACTGTGGGAAGGACAGATCGGCTAACGAAGACAGGTCTCTTAGGATTCGC
CTCCAATCCCTCCTTGGAAACTCGATGGCCTAAGTAATCCACCTTGCGCATCCTCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACAC
GCTCTCCAGTAGGGATGTCACTCTTTTTGCATAACTGATCTCACGATTCCCGCCCGGGAATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGA
CGGGGTCCCAGGATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCCGGATTGCCTTCCCCGGATCCACCCGTTTCGGGCTCCGGTATTCGGGTGAAC
CCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGGTCCACTCGAACAGGCCAAACGGTGTGATGA
ATGCGGATATTGCGCGAGCTCG