Description :
From Genome Similarity Track
Location :
Scaffold_382:436- 1448
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_382-fgenesh-gene-0.3Hydrolase, HD family protein

Sequence
1012 bases(100 bases per row)
CGACCATCGATCTCGGACGCCTACTGCGCGAGGAACTGCTGCATGAACGCATGGTGCTGCTCTGCGATGCGTCGCCCCGTGTTCGTCTTCATCATGACAC
GCAGCTTCAACAATTTCTATAGAAAAAAATAAATGCATTGCAAATTGCAATTTGCAATTGTACGAACAGCGTGCGAACGCATGAGCCTCCAGTCCGCCAT
TGTTACAACAGCATGACAAGACTACACACCTCGTAGAACATGTCGATGGACATGCTCGGGCGCGTGGGGTCGACGTATGCATCCTTGGTCATTGATAGAT
ACGGTGGGATCGCTGGGTCGAACAACGCGCGTCTCTTGGCGCCGCCGTATGTAAAGGCTCGGGCGATGCCAATCACGTTCTGCACAAAGAACAGGTTAGC
GTCCATTTGACTCAATAGTCGACATCAAGCGTAGCAGCCATCCTACCAGATGGTCGGCGTCTTGAACGCAGGCTAATTCCGGTGAAACAAGCCGCTGTGC
GTCGTTGCAATGCGTGAAAATATAAAGAAGAAATGTCAGTTGTGCCACCGCTAGATGCCACACGCTTAAACGCACTTTTCCGTCCTCGAGCTCTTCTTTG
AACCCAATTCTATCAATGACGGAGAGCACGAGCGCGATTTGGTCTCCCGCTACNNNNNNNNNNNNNNNNGCCTCGCGAGCACAGAAACGTCTCGGCGCGC
TTCATCGGTCCGCTCTCGTCTTGGTACTTGTAGTCGTCAATGTCGTGCAAGAGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGACACA
TACAACACACTCAGTTGGCACACCACGACATGCTAAACAAGAAGCTTGCGTGCAAATGAGGACACCTCTTCCTCCGCAATGACGCGCGCGAGCGTCCACA
CGCTCTCGACATGGCGCCAGTCATGCGACGCGTCGTTTGCCTGCAATTGGTCTTGCACGAAGGCGATGGCGTCTTGCACGACAGCTGAGTGTGCCATCGT
CCACATCCACGA