Description :
From Genome Similarity Track
Location :
contig_44:435869- 437137
Transcript NameFunction/comments
g8010.t1conserved hypothetical protein

Sequence
1268 bases(100 bases per row)
TTGAATGCTTTTTCCTTGAGAAAAGTAATCGTGAGTATATTATGTTCTTTCTCTCTAGGCTTCGCAGTGAGGGGGCAGTAAACTGAGGACTTCAGTGTGA
ATTGCGTAATAAGAAGTTTGAGTTTGGATGAGTCTCTGATTGCGACGGAGAAAGATTACGAGATGCTCCTCGATACCTCGTCAGTTAATCGTACACAGAG
ATGTTTCGCGGCTACACGCAGTGCTGTCCAGCATATTATGTACAGCACGGGATATCTAGTACTGTAGCTTCTTGCTCGTGTTGCGGAGACATGATGAAGA
TGGAATGCGAACAAAGTTGCCTAATCTCGTTCGTGACGACAGCATGTATTGAGGTGGCTTGTTGGTGGCAAACCATCTGGACTACAGAAGAGATCACGCT
ACTTTTACTAACAAGACGGCGCCGTAATAGTAGCAATCCATAATTTATAAATCTGCCAGGTTGTGTGCTCTTCGAGTTTCTGTTAGTAGACTTTAGTTCG
CTTTTTCTTTCGACTTCCCAAATCGCGCTATTATCAGTCCTCACGATTCCAACGAAAGAGACTATTGACGCTTTCCAAGAATGTATGCGGCATGGGCATT
CTGCTACTGATTGCTGCGATCGCGCTTTTCGATCGTTCCCACGGCCTTGACAGCGTCAAATAATGTTTTTGCACCCCCGGTTGAAACCGAGAAAGCAGCA
TTGGAGTTCAGAGGTTCCAACGCACTATCGAAGTGATTGCTATGAATGAAGATGCTACAAAGAAGAGAGAGATTTGAATTTTGGATGGCCGATGAACCTG
AAGCAGAATGTCCTTGGCACATCCGCAGAGAAGGCGGCTAAAGAGGCAGCGAAGAAGGCACAACTCCAAGTAGCCGTGGCGAAGGCGATGGGGAACGAGA
AAATGCTCACGAAGATGCCAAGCAACGATGAATACATCTTCCGAGCGTTTAAGAAATGGCACTTTAAGACGGGGTATTTGTCAAACAAGTCGTGGCGATG
ACTACAAAACTGCAATTCCATCCCATTGCTGATCGTACCGAGTGTATGTACAAGATATTGCTGAAGGTTCTAAAGACGTTTGAGCTTAAGATACAGCCGC
AGCAGCAGCGTAGTTTTGAAACGTGAATATTATAGTCATTCCCTCAGCTAGGATAGATACTACAGTACTTCTTTATGCTCTCCTTGAAGTTGCTCCACAT
CTGTATTCCGTCCAAAAGAGCATGTCGATCAAAAACAACCATTTGCCCAACCATCTTCAGATCCAAAA