Description :
From Genome Similarity Track
Location :
Scaffold_29:43579- 45051
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_20323Hypothetical protein

Sequence
1472 bases(100 bases per row)
CCGCATCAAGGAGAACAAGGAGGTGTACGAAGGCGAGGTGACCGAGATCACGCCCGAAGAGACGGAAAACCCCCTTGGTGGCTACGGCAAGACCATCTCG
CACGTCATTATTGGCCTCAAAACGACCAAGGGTATAACCTGTAACGAGAGGAGGAGTCTCATCTTGTATGTCGTAGGCTCCAAGCAGCTTCGGTTGGACC
CAAGCATCTACGAAGCGCTGCAGAAGGAAAAGGTGTCGCCGGGCGATGTCATCTACATTGAGGCCAACAGCGGCTCGGTCAAGCGTGTCGGTCGTTCGGA
CGCGTACAGCACGCATGCAGCCTCTCTCGTGTGCGCTCATGCGGCATTGCTAGGTATGCGACCGAGTACGACTTGGAGGCCGACGAGTACGTCCCGATGC
CCAAGGGCGACGTGCACAAGAAGAAGGAGATCATCCAGGACGTGACGCTCCACGACTTGGACATTGCGAACGCCAAGCCGCAGGGCGGCCAGGACATCAT
GTCGATGATGGGCAACCTCATGAAGCCCAAGAAGACGGAGATCACCGAGAAGCTCCGCAGCGAGATCAACAAGGTCGTCAACCGGTACATTGACCAAGGC
GTGGCCGAGCTCATTCCGGGTGTTCTGTTCGTGGACGAAGTACGTCGATGCGGCATACGATGCATGTTTCTTAGCGCATCTTAGGTGCACATGCTGGACA
TCGAGTGCTTCACGTATCTCAACCGCGCGCTCGAGTCGACGCTCGCGCCCATCGTTGTGTTTGCGACCAACCGCGGCGTCTGCACCGTTCGGTACGCGCC
GCTTTGCCGATACATTGCGATCTCAATGTGATGTAGCGGCACGGAGATCTCGTCGCCGCATGGCGTGCCGCTCGACTTGCTCGACCGCATGCTCATCATC
CGCACGATGCCCTACTCGGTCGAAGAAATGGTGCAGATCGTGAGCATTCGCGCCGAGGCCGAGGTACGACACGTCGATCGATCTCATTTCTGAGAGGTCC
GTTCGTAGAGCATCCCGCTGGCTGACGACGCGCTCGGCCGCCTCGGCGAGATTGGCGCGCAGACGTCGCTGCGCTACGTGGTGCAGCTCCTGACACCGTC
GCGCATCATGGCCGAGACGCAGGGCCGCACCGACATTACGGCCGACGACGTAGATGAGATCCACGACCTCTTCGCCGACGCCAAGCGGTCGGCCAAGGCG
CTCGCGGAAGGCGAGGGCTACTTGTATTAAAACCCAACTTTGACACGCAGCGATGGACCTTATTATGACGTACTCGGTGCGCATTCCAATCTACAACAAA
GAGCCACGAAGTAATACGGGCTTGGACAACCAATCCTCGAGACAAGAGATGGAGGACCCTGCGTCTTACTCGGCGTTACGCTCCCTTCTGGATCGTAGCA
GCGTCGACTTTCACGGAGCCATATGCACGCGAAGACGTGTTCGATCCAACTATCCACGCATGCACCTATCCA