Description :
From Genome Similarity Track
Location :
Scaffold_165:43572- 45390
Transcript NameFunction/comments
Physo_144083hypothetical protein

Sequence
1818 bases(100 bases per row)
ATGATCACTGCGTCTGTGGGCGCGGGCTCGAGTCTGCTGCTGGAGCCGGCGCGCGAGCTGCTGTTCCCGCTGCCCGACGCCGCGTCGGAGCGGCGACCCC
GCTGCTGCCTCTCGCTGACCAACCTGTCGCCACTCAATGACGTCGTCTTCCGCGTGCGCACACGCAACCCGGACGCGTTCACCGTGAGCCCGACCCACGG
GCTGCTGGCGCCCGGCACGAGCCTGCAGGTGGTCGTGAAGGCCACTGCTCGCACCTGCGAGCGGCTGACGGCCATGGACCCGCGGGACTTGATGACCCGC
CAGTCGTCCGAGCTCTTCCTCGTGCAGAGCGTGGAGCGAGAGGATACGCTGGAGCCGTTGAACGCCAGCTCCAGCTCGTCGCTGCGGGCGTTCTGGAAGA
AGGTGTCGAGAGATTCCATCACGGAGAACAAGATGGTGTGTCGCTTCAAGGCTGCGATTCCGGGGTTTCCTCCTCCTCTTCCTGCGTCGGAGATCACTCA
GGATGATAAACTGTTCTCGAGAAGTATGAGCAGTGCGAGTTTGGACTCGATGGAGTATCGTTCAAGTCGCGATGATGGTAGACGCTTGAGTTTGAGTCGG
AGGGAGTCCCGCTCGAGTCGAAGTCGAAGTGGAAGCAGCAGCGAGCGGAGCAGACTCAACCGATCGTTTAGCAACCAGTTCACGCCGCCTGAAGAGATGC
GGGGAGATAGCGACGGCAGCCGCAGCAGCAACCACTCGTTCGCCAGCGATGCCAGCTTCCACACGACGATCGAGCCTCCCGTAATGGACCGAAGGAGGTC
GGCATCCAGAGCCTCTTCGCTGGCATCTAGTCGGCCGACGCCGATGACGAGACTGCGGGACTCAGTGCTCACTAGCATCAGTGTGAACGACGGCTCTGTT
AGCGACACGATGCTGACTGCGCTCTCTACTGACACGGCGGCAGGGGAGGCGACCCACGAGCTCGGTCCGCTGCAGTACCACATTCAGCCCAGCAACGTGC
TTTCGTTCAAGGTGAAAGCCGCACCGCGTTTTTGGGGAGGCACTTCTCTATTTGTAGTGAATTCGAGCCAAAAGGACTGCCTCACCTTCAAGGTGCGAAC
GTCGAATCAATCGGGCTATGTTGTGAAACCTAGCAGGGGACTGGTGTCGACGACGAATGCACAGGAAGTCTTCGTGTCCCTGTGCGCTCCACGCGACGAA
GACAGTTTCGACCCAGCCAAGCGCGAGGCGAAAGACGGATTCATGATCGAGGTTGCCAACATTTCGCGTGACAAGTACGACGACTTGATGAAGCTAGACG
AGCGGAAGCGCTCGCGCGAGATCAGTTCTCTATGGTCGTTTATGCCTCGTCGTGACCGTCAGTCGACGATGCTGTCGGTCTCGTTCAAGATGGATGGAAG
CGATAGTGGCAGCATCACCCGCGAGAGTTCTGTCAGCGGAATCTCGGATTCTCACAGCACGGACAGTGCTGCTGTCAAGCAGGCCTCTCCGCCCGCAAGA
CCTCAAGCGCAAAGCTTGAAGACGGTCGTCCAGGCAATGGGGAAGCTTTCCACTTCGTCCTCAACGGAGTCGCCTGAGAGCACATCTGAGGAAAAGCCTG
GGTCACGGTATCAATATTCCGATTCGGACGAGTCAGCGTTCACTATTGGTCCTACCCCCGTGCCCACTGAAGTCGGCGATGATAGTGACAGCGACGCTGG
CGGTGTAGCCTACGGTTCAGCATCCAACGCCACGAAAGATCCCGCGGTGATTGTTGTCTCGGCTGACAGAATGGACACTGTCGACTTCTCCAACCCGAAG
CTGTCCTTCTTTATTTAG