Description :
From Genome Similarity Track
Location :
Scaffold_22:435679- 443604
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G008441Similar to SPAC2F3.16: Uncharacterized RING finger protein C2F3.16 (Schizosaccharomyces pombe)
Pytul_DAOMBR144PYU1_G008440Protein of unknown function
Pytul_DAOMBR144PYU1_G008439Similar to Samd8: Sphingomyelin synthase-related protein 1 (Mus musculus)
Pytul_DAOMBR144PYU1_G008438Similar to Rai14: Ankycorbin (Mus musculus)

Sequence
7925 bases(100 bases per row)
TTGTGCTCATTTGTTGCATCTTTGTCTCGTATATGGCATTGGGTCGTAAAAGTACCAATTTTGGTGTGCTAGAATGAAGCGGAGAACATTCTTGGTTGCA
GTCACTACCAGTACGTGCGTACTGCGCTGAGGTTCCATTGGCTTAGTGCTCACAGTTTTCTTCTTGCTGCTGCGCTTTATCAGACGAAGTTGCAAACTGC
AAGCGAAATGCTGTGGAAAATGGTATCCATGCCGATTCTGCCATGGTATGTTTGGTGCATGCTTTTGAGTGCCGATTGCGATGTGTACAAGCCGCTAAAA
CGAGTTCATATTCGAATGCCTATATGGTGCTTCAGATGAAAATGAAAGCCACGCAATCGATCGCTATGCCACGGAAAATATCTTGTGCATGAAGTGCGAA
ACAGTCCAGGTAAACGATTGCAGTATGTTGTCGTATTCATGATGAAGACGATTTCAGCTAAAGAACTCGTTCGTATAATTTTGCGCAGCCCATGTCGAAC
GAATGCATCAATGAAAAGTGCAAAACGGTGTTTGGGCGGTACTTTTGCGCCACGTGCAAGTTCTTCGATGATGACCCGACGAAGGACATTTACCACTGCG
ACAAATGCCGAATCTGTCGAATCGGAAAGGTTGGTGCTTCTCAAAACTATCGGATATCCTGTGCTTGCTTACAATCCGTGCATTCTTGGCTCATGTATTG
TTTGTTATGTTGCTTTGTGTAGGGCCTCGACATTGACTACTTTCATTGCGATCGATGCAACGCATGCATGAGCATCAGTCTCAAGAAGCACAAATGCGTG
GAGCGGTCGCTGGAATCCGACTGCCCAATTTGTCATTCGTATATGTTTACGTCCACGACGCCCGTGATGTTTCTGCCCTGTGGCCATTGCATGCACGTGT
CCTGCTACGAAGAGTATACCCTGGTAAGCCATCATGTATGTCGGCGTCATGATACTCCTCATCCAAATTGACGCGTTCTCTGTGCTTTTCCTTCTGTGTC
AGACAAATTACATCTGCCCACTCTGCTCTAAGTCGCTGGGCGATATGGAGTTGTACTTCGCAAGCATCGACGAGCTCTTAGAACGGGAGCAAATGCCGCC
CGAGTACCAGGACTACAAGTCCTTTATTTATTGCAGCGACTGCGAGCGCAAGTCCACTACCAACTTCCACTTTGTGTACCACAAGGTAAGCGTGCAGCAG
CACTTTACCAGAAATGATCGGCTTGACTAACACTTTGGCTTGCTCTTCTTTCCAAATGCCGCAGTGCCAATTCGAGGATTGCATGTCGTACAATACGAAA
TTGCTGCGGCAGTTCAGGGAGTTGGGCACCCACGTCGCGAGCGCGGAATCAGAGATTTTGGTGAACTTTACCCAATGACTAGAGCCTGCGCACAAACGCA
CACAAGCAGCCACCAACTATTATTTCAATAAATATAAACTATAAAACCCGGCAGCGAACTGCCACAATGCACCATGCGCATGCAGATATATCGTGGTTTT
GTGAATATGTATGACCCAGTTCTTGAGAAATGTCAAACGGAGACGTTGTCACTCTCTACACACAAAAGTCAAGTCTGTTCTAGCGTGTGGGAGGCAGCAT
GGCACGACACGGGAGACCGCACACGACACTTTGCAGCGCCTTGTGCGGCCATAACGCCGTGCCAGCATCCATGAGACCCATCGCGCGATATGCACATCCA
TCCATACAGTACAGTACGTATACGTCATATACACAGAGCAGGTTCCACGCGCTTGGACACTCCCATCGTCCTCTCTCTTTTCGTGGCGGAATTGCGTGAA
TGATGTTTTCCCATGCCAAATTGGGCCAAATTTGCCTGTAACCACCAAGGCCTTAGCACCAGTCACTCACATGACGCCATCCGACCGCGATTATATTTGT
TTTTTGTATTGCAAACGACCGACCAACCAAATAACATATTTTATATTTTATCCAATCACATATACAATATGTCCACCAATGAGGAGTTAGTATTCGGTTC
AACATGCTGGTGATTCGCCAGTAGTACGGAATAGCTGCATTCTCGCGATCGGCAACTCGTAAAACACCGAACGCTCGGCAATAGCAACGTGCCTAATTGC
TCAGACTGCAGTTTCAGCATGCAGCTCTTTCTTTGTTCTGCCTCACGAATCTATTGTTCACCTTAGGAAGCACCAGTGATTCTCGTAGCCCAGGACAGAA
TTTCCTACCTTCATAAAAAAAATCGGGTCACAGCTTCGACTTGGGAAGCATCGCTGGACGGTGGTTCTCGTAGCACCAATACACATACTTGCCCACCTTG
GATTGCTGGAGCTTCTCAATGCGTTGGCGGAAAATACGGTCTTTGATTCGATCCACTGAGATATACGGCGCAATGTAGCTGTGTTGCTCGGGAAAGAGCA
GCAAGGACATGTGGGCACAAAATGTGATATCAGCCGCGGAAAGCGCGGATCCATCTAGGAACTGAGTGCCAATGGCGCCGGCGCCAAGTCGCTTCTCAGT
TTCCTCCAAAGCACGTTCGATTTTTGCCCACGATCGTTCAGCAGACTTGGCATTGACGTTCAGCGCATGCATCAACAGCGCTTTCAAGACCGGACGCAAC
AGCCACGTCAATAAATACTGGACATAGCTGTCAAGCGGGCCCGCCAGAACCTGCCAAGTTGCAGTAGAATCCGCGAAAAGAATGTGGTACGCTTTACAGA
ACAAATATATATGGCATACACACAATCAGTGCACATTCGCAGCCGAAAAGCGCATGCATCCATTTCCGTACCACAACGTCTCACGTGCGGCCCGAGCTTC
TGGTCGTACATGAGCTCGAGCTCTTTCGTGCGTGGCGTTGGATACAATTCCGGCCGCTTCGTCGCACAGTAATCGACGATATCGGCACTATCTTTCAGCA
CGAGGTTCTCTGCTGGCACTACAAGCAGAGGGACCGATTTGCCGCCCTTGGGTATCGTCGCCATGTACGCGAGCAATGGCGCGTACTTCGCTTCCGTAAA
CGGAATCCCAGCAAGCTGGAGCGCCCATCGCGCTTTCTCGACGTAGTTGGACGCGGGGATCGTCACGAGTGTCGCCATCGCCATTCTGCCAGGTAGATTC
CGCTGATGATAGCGGACGCGGTCCCGAATCATACAGATTCAACGCACGGCCCTTACATTGGCGCAATAGCCACGCTATTATAAAATAAAGAGTGTGTGGA
TAGTCAAATTAGTATCAGAAAAATTTACTGCACAATTTATTAGATGTTATAAGGGTGCTTATCACAGGGATACGAGAAGTGTCGTGCTTCAAGATTGAGA
CCAATGGCAATTCAAAAGCGGATCGCAATTCATTTTTGAGTCGATCGACAGCAATTCATAAGAGTTGAAGTTGAACCCGCATTTTTTGCCGTCAGTGCGG
AATTGACACCAAGGACGACGAACGCGAGCAGGAACGCAAATCACAAACACACCGACATGCGCCGATCAAGGGAAGAAAGTGACGGTACGACAGCGATTTA
CTCGGATAAGCAGCTCGATGTGGATGGGAATTTTGGATGAGACCCTCACTGTTGTATGCGCGTATTGCTTTTTTCTCTCGTTCGATTCAGACGCTGCTGT
GTTCGAGCAAAACAAGCGCCTTCGTGATGGTTTGAAGATCTACACTTGCTGCGTCTCCCAAGTTGGATACGTATTGCTGGTGTGTATGGAGATCATCTGA
AAATAACGACCTGCGGTTTTCGATTAGGAGGTACCAATGAAAGCGAAGACATTGTTGGTGACAATTTCCTGAAGAGCCTTCACTCACAGCTTGCGAACAA
CTCGCCAAAAGACCAGATTTTCTGGATTGATGGTGGTACTCGTTTTCAACTTCGACCTAGGAGCCACGAGTGTTTGAGGACTTGCTTTGGAACATCAAAG
CGAGCATTTGAACAAATACTCAAAAGCTTGGAGTTTCAGTGCTGCGAAGAAGCAGATGACTCTGGAGATCAATTCTTCAAGCACAGCAAGTTTACGAGGC
AAGACGTCCCAAGAGCAGAAGAATTTTTTTCAAGCAGGAAGTCGAACGTCCGAGACGAGTTATGTGAAGATCTGACGGTGCGCATGCCAGATGTGTCCTA
CAACCCCGCTTTGAACCCGTTGGAAGTGCGTGTCAAGTGTTCTGGGAGCGCATCCCACTGTGAATCATGGCATGTTGTGATAGCGTCAAGTCTTCAGCCC
GAGGTGCCTTCGACGGAAAGAGCCTCCAAAAGTTTCTTCCAACAAAAGTCTTGTGGTGCTGAAAGTACCCAGCTGTCATCTGGGACCGATTCGCACTTTG
ATCAGGCAGCGGCGCCGTATTTTGTATCGGGATGCGATGACAGAGACCAAGAATCATACAACTGGATAAACCGTCCTAGCGATGCGTCAAGTCTCTGCCT
GGATGACCTAACAGACATTGACATTCTCTCACAAATCAGTGCATATTACGGATAATAAAGCTCGCATATGCATTGGAGATTAACTAAGGGTGCGTTTAAC
ATCATCGACTAACCAGTGCTGTGACAGCTAGTAAACACTGACTGCTGCAACGAGGTGTGCAATCCGCTATCGCCATTGTCAACCTCATTGGAGAGAAGGC
TATGGCGCCATCGCTTAATCAATGCTGTGATAGCCGATGGTGGCTTGCTGCTCCACCATAATATGCAATCCAGTATTCTCATTGGAACCTAAATGCGCGT
CCAGTACCACAGCCGATACGGTTGGCGCATGGTACGGCATAAGGTAAACGAGCACAAGCGTGAGTACTCCAGCCAGTAAGACACTCCAGCAGCACGGAAT
ACCACAAGCAAAACGCAAGCACGCCGAAATCCAATACAAAATTTCATCTATCAATCAGTCACACCAGGCGACGCACTCTCTTCCTGCGAGGGAAAGAGAG
CCACTCGTCCGCCGTAGTTCCTTTGTTTTGTCCTTCTTTCGGGCCTCAAATCTACACATGTTACATGGAGTTTTTGCGCTGGAATTCGGTTTGGGCATTA
CCTTCGCTCTCCGTCAAGAAGCCCTCCTCCGCGGTCGCGACCTGGACCGAGTCCAATGGCTGCGTGTGGTGGAACTCGCCGCCGACTTCTTCAGACACGT
CAATGCCGTAGAACTCGTGGATCGTCTTCACCGAGACGCCGACGTCCTTGTGGTTGATGTCCTTGTAGTACGCGTCGTGCGTCAGCCAAAGCAGTGGCAC
AATGTAGAGCGCCGAGAACACGTCGAGACTGTAGTGCTTGCGCGAGGCGACGATCAGGAACGCGATCGCGATTTGCACGCATGCAAAGAACAGCAGCAAC
CACCGGTTTGGCCAGTACTTGATCGCCGTCAAGATAAACGACATGGTGTAGATCGTGTGCGAGCTGAACATGAGGTCACCGCACCCGTTCAGAGCGTCCA
TATTGGTGAAGAACTCGTGGCCGTGGGGTGGCTTGAAGTCCGGGTTCGGGATCACACACTTGAGGATGTCGTCTCGCGGAGTCTGCGCCACACAGGTCTC
GTCAAAGTCGAGCCGGCATTGACGCGCTGGGCCTGGCAGCGTCGTGAGCATGAACGAACAGATGCGGAAGATCAACGCGATACTGATGTGCAGCAACACG
CGCTTGAGCACGATGACCATGTAGCGCGGCTTCTGTGGGTTCTGGCGGAACAACGGGATCGTCAGCACCAAAAAGATCGCAGGGGCGAACACACCGCCAA
ACACCAGGTACTCGGAAAAGTGCGAGTTTGACTCACTGTACAGCACAGCAACATACAACAAGAGTCAGTCTTGCGGTGCCGAACAGACTTGCTGAATGCG
GGAGATCATCAAAGAACACGCACCTGAGCTCTGGCATGAGCGAAAAGCCCAGATCGTGGAGCACGAAGCGCTGCTCCAGAGAGAGCTTGTGCCCCTGGAC
CCAGTACGCCAAGTTGTGGAAGACGCCGTGGATGTCTACATGATTAACAATGCGAGAAATGTGAGTCAGCGTCCACGCGGCATGTAAAAAAATCATCTTG
GCCGCCACTCTTTTAGGAAAAAGGGGGACAGCGAACAGTAGCAGCAGCAGGGGACATCGACGACTCACACTGCATGATCACGCACGGCAGGATGATCTTC
CACTCGGCCTTGAGCAGCTGGAGCTCGATGGCCACGTACTTGAGAAAGTTCTCCTTCCCTCGGAGCTGGAAGCGCTTGAACGTCATTTTCGGAACTCGCT
GTGCTGCTCGTCCGTCGACAGGGGGCGGTCGCGGCCGGTTGCTGCACGATCGGGCGGAAGGGGGAATGGGGACGGCGACCAACAGCAAATGGGCCCGAGT
GGAAGAGAACGAAGCACCGGGTGGCGGGAGCTCTTCGATGCTGCTTTTCGAAGTGCCTGCCGACAAGACCACGACCAAACCCTTCTCTCTCTTATGAATG
CTCGTTTGCATAATCACTAAACTGGATATCTGGAGGAAAACCCGTCATAGTACATATCCTATCTTTTAATATACTGTAAATCTAAAAGTCAAGTTAAACT
ACTAATTAGATAAATTAGCCTGCAATTATATCCTGTATTAATTGGTATGTATGTTTAATATGATACAGTTACGATTTTGGGGTACGATTTTCTTTCATTT
TGCTCTTTTACCTCTTGTGTGACAGACCGGTTACTGCCCGCAAAAGACGACAGTGTACGGCGTAATCATCGCGCAAGGGAATCCCGTCGAACGCGTCGCA
ACATCATACAGTACACTGGATGAAAAAGATTATGAGCGGATGCTGTTTTACCCTCTGTTTAAAGGAATGTGTTGTTCTAATATCCTGTATAATATAATGA
ATGGATATCAACGTAAAAACAAATTATATGTTTGAAATCAGTATAGTACACAAATAATAATATGAAATATAATAACCTTTATGGTTGGATTAGAACCATA
GTAATGTGAATTTAGACTGCACAAGCATTTCTTTTTCGTTTTGCAAAAAAGCTCCTTCAAGTGCATGCAGGTAATGTGGCAAAACACGGATGCACCACTT
TCTTCTCTTTTACTAGCACACATTTTCTCACCATTTGCTAATGCGCGATTGGATGCAATGTACCCATCCCTGCACTGCTTGGAGCTCCTGTGTAGCAGAC
AAAGGGCTCCACACTGCGATTGCGCCATTTTCGACCCAAGTTTACCAGCAGAAAAGCTGACCGAGATTTTCGCAGACGATTGCGTCGATAGGACGAATGA
ACGGCATTTAAAGTATCATCTTAGATCCACGATAACGTGGCGCGGTGTATATCGCTTTTCTTATCAGTGTGGCGAGTTGCAACAGTCCATACCGCCTTCT
TTAGGCGTTTTTCCACGCTGGCGATCAAAAAAATACCATGGAGTTTGGATACGGATTTGAACGGATCAGGATCGTATTCATAGATAACATCGGTTATTTT
TTTACTAACGTGAATGGAGACTGCTACGCGCGACTCGCCGGCTCTGGGTTGGATGCGGTGGCAGCAAACACCCAGGAAGCGCAGACGGAGGGACATTATG
GCGAGGCGTCTGGGCGATCACGATCCAGCGAGTGCGCGAGGTGAAAGCATGGCCAGCAGCAGCAACAACAACAATAGCAGCCGCCTTGATAGCTCCAATG
ACAATGACGACGCTCTTGAAGAAGAGCAAGATGACAATGCGCGCGGTGCGCATCTGCGACTCGCGCAGCGCCACAAGAAGATCGTCGCAGGCCGCTTCAA
AGGTCGACGCGTGCTGGACGTTGAAGAAGCAGCGCCAGGCGTTCGGGGCCAAGTCGCGATTTGCTTTACAACAAACGGTGCATTAGCGAAAGAGAGTCGC
CTCGTGTGTCAATTCCCCGACCATGGGTGGGGCATCCCGGCATCCCCAACTGCGATGCTGAAGCTCCCGCAAGGTTGTGCTGTGCCACAACTCAAGTCCG
CTTGGCAGCCGACGACGCGTCTCCT