Description :
From Genome Similarity Track
Location :
Scaffold_242:4356- 7453
Transcript NameFunction/comments
Phymu_g7396hypothetical protein PHYSODRAFT_330577
Phymu_g7397serine protease family S33, putative

Sequence
3097 bases(100 bases per row)
CGACAACTCTGGAGATGACGCTACAATTTCTCCAGGGGTTAAAACCTCAATATCATCAGGTAAGTCATCGGTCCTTCTACTGTTCGCCTTCTCTCGCTTG
AGCTTGCACCACCGATAGGCGAAAAAAACGGCAAGACCCAACGCTAGAacgaagagaacgaggaacGTGATGAAAGCGGCCTTGTACGACGATTCCTTAG
TCCTCGAGTTCGACATGATACTACCAGACGGTCTGGCAGACCCCCCAAGGCTAGTGGAGCTTGAATCCGTTACCGCAGCAGCCAAAGATTTATCATACAC
ACCGTCATACATGTCgctcgtgctcaagaagTAATACTGGTAAGCACGCGGTGGTGTCAGACTGAAGTCGGGCATCTCACTAACGCACGAATTGTCCAAT
CCACTCAAATCTCCGCTGTTAGAGACGTAAGACACGAGCAATTTCATGCCGCACGTCTCGCCTCCATCGTAACTACCGCTCATAGTTGTCGTCCACAGAG
TTGCATGGGTGGCGTAGTCGAACGTGATCAGCTCCTTATCGTCCCCGTTCAGTGCATTTAACAGGTATTTCGCGTACTTGTGAGGCGTCTGAGGGTCCAA
TTTACTGCTCAGAAGCAATACGCTCGCCTGTGGAGGGATTGTGGCGCTTTTGTTCCAGTATTGGTCGCGCTCGTAGATAATTCCGTTGCCGTCGTAGCTG
CCGACGTCGAACTGGTCACAAACTGACGAAACTTCACGTGAGAAAGCGCAATACTGCGGGATATCTGCATACGAAGCCCCGTTCGTGATTCGCGCATTGG
TAAACCTCGCGATCATCTCGGAGATCGACGGCTGCGGGGTCTCCCACATCTCGGAGAACACGATGAGGTAGTACAGTAGAGAGGAGCTAAAggcgtcgtc
ttcactgccCGAGGACAAATATTCGTAAAAGGACGTGAAAAAGCGCGTCAGGACGTCGATATCCTTGGATGCACAGCGATTCAACCGGTAGACGAGAGGT
GGGATTAAAGTTCTCGTAGAAGCACTTTGCAGGAGAGACCCCAGAGTCCGTCGTAGAATAAATGACGCTGGTTCGCTGCTCTGATCGCTGTACAGTTCGT
TCACGAGAGCAGCACACGTCGAGTCCGCATTGTTATCGAATTTTGTGATTAAATTTTGTAGAGTGACCGCCAGATTGTTGGATTTAAACCGCTCCTTGCA
CTCCTTCTGCGTCTCACACAGGCCCAGAAAGTCATCGCCCACGTCGCCAAAGTCGGAATCCCATGTTGAAAAGTATTCAAACTCTTCCGACGACCCAGAG
CTCGTAGCAACGCCATCTAACACATATCCAGTCACTTCTGGAGGGTCCAAGTGGATCACACGCTCGACTAATGCGCTACCGTAACTTACGCCGTACACAA
TGGTCTTGGCGCCGTTGGAGTAGCTGGAAATGAACGTCGCAACGTCCGTAGCGGCGCTAGTCATGGAGAACGACGACAACTTCCCGTATTTCCTCTCCAA
CGCTTTGGCACAGGCAGGGACTTCCGACGGTTCGATGTAGCTGCCCCAAGGTGATCCGGACGTTGTCGCCTGTGCTGCAACGCAGTCCAATAACGTGCTA
CGTCCGGTACCGCGATGATCCATAGTGTAGACGTTTACAGCTCCGTTCAGTCGTCCATGTAGTTCTACCATGGCTGACTCCACTATCACAACGAGTTAAT
ACTTAGTAAAAGTTCTTGGACAGGATTAATCCCCCACTTACTAGCAGTAGATGAAGCTCCAGGGCCTCCTTGGAGGAGCCACACGTTGGTCGCAGTGTTG
GCTTTGCGTACAGCAGGCACACGCTTCACGAAAATGTCCACAGTTGAATCTATGGACTGTGGGGTCTTGCAAATTCCAGTGTAGCATAAAGGAGCGCTGT
AGACTGCGCACTCGGCGTCTTGATCGCCGGAGCTTTCTTCGTCTGCAAAAGTGGACTCTGAACATGGATACCACCCGTTGAGATCGCtacttgaagcaga
actcAACGCAGCCGACACCCGAGCGAAAGCAATTGCCAGCGAGACggcaaggaagagctgcatcGGAAGCCAAAAAAGACAAAATGGTGAATCGTCGAGC
GAACGTCTTCTTGGGTTCAGGAAATTCTCTACAGAATGCTTTCTGGACCGTTGAGCCTTTCACGCGATGCTACGTATTAACAGCGCTAATTTAGAGCTAA
CTACGTGTAACCGCgatgcagctgaagctcgtaCAGGTACAGGTTTTCATTTCGGTGCTAATTCTTCACATTTCCATGCCTCAGAATTCCCCTTAGACTC
CGATCTCCTTAGTGGAAAATGAAGTGGTCTCGGACGATACAGTCTCGACTGCGACTGGCGTTGAGATATCGACGTGTTGTTCTTCGACAGTCACTCCCTC
GTCCGCCTTCGTCTGGTTGCCGGCGCACAGAAGGAAGAACAcgaccaccagcgccacaataaagagcacgaggaaggcgatgaaAGCGGTCTTGTAATGA
GAGCTACTTCCGGACGttgagctgccactgctgctggtcagTCCAGTTGACCCCAAACTGGCGTCGTACGTGCCGTCGTAGGCCTCGTCCGTGCTCAAGT
AGGTGTACAGATAGGCAATCGGCACGGTCAAGTCGAGCGCCGGCATGAAACTAGCACAAGACTTGTCCAGACTGTCCAAGTCGCCGTTATTGCTCACATA
GGACACGAGCAACTTCATCCCGCACGTCTCACTGCTGGCGTCTCCAGCGACCGTCGGTGTTGTCCACAGAGTTCCGTGCGTGGCGTAGTCGAACGtgatg
agctccttcttgtcccCATCTAACGCCTCCAGCAGATATTCAGCGTACTTGTGTGGAGTCTGAGGGTCCAGTTTGCTGCTCAGTAGTAACACACTCGCTT
GGGTAGGGATCGTAGCACTCATGTTCCAGTACTGATCCCGTGCGTAGATGATCCCATTGGCGTCGTAGCTGCCATCACCCAGTTCATTGCAAGTCGTCGA
GTTTTCCTTGGAGAACGCACAGTACGTCGAGACTTTCTCGTACGTTCCGGTCGAGATCGTCGAGTTCGTGAACCGCTCGAGCATTTCCGACGCTGAG