Description :
From Genome Similarity Track
Location :
contig_10:43558- 49512
Transcript NameFunction/comments
g3253.t1hypothetical protein
g3254.t1OWZ18625.1 LOW QUALITY PROTEIN: Retroelement [Phytophthora megakarya

Sequence
5954 bases(100 bases per row)
ACAGCCTTCGGGCAGTCAGCCTGGAGCCGCTCGATCGGCTCCCATGAGTTCTGTGACGAGGGATACCCTCGCCACTTCACCAAGAGCTGGCGCTTCCTTT
GGCGGCGCCGCTCACGGAGCACACGCTCCACGTGGTAGTGGGTTTCCCCATTACGGTCGAGGAGGGCCGGCGGAGGCCTTGCTCGACTATGCGTACGATG
CTCCGCCACAGCGTGAGGCTCCGAGATCGTCGGCGCGATCTCCCGATCGGTCCGTGCTGCTTCAGCAGCAGGAGATCCACGATCTCCGTGATCGAGTGTA
CACTCTGGAGATCGCATTGGGTCTCGGCCCTGGTGGGCAGGCTGCCGCTCAGTCGGGAAAGCCGGGGTCTCTTCCCCTCCTTCGTGGGGATGTGGACCGA
CTGAGCCAGGGTGTGGGGATCTCCACTCCCGGGTCGATCGTCGTGCGTCGTCGTACGACGTCGACTGTCTTCGCGACGAGGTGGCTCACCTCCGTTTGAG
ATCCAGAACCGGCCGAGCTATCCGGGCTATCGGGAGCCGCAGTCCTATGCGTACTCCCAGCCGTACTACGGTTCCTACCCGTACGGCGGGGCGTCTTCGA
GGTCACAGGCTTACGCCTACGACCAGTCCCCTGCGCCGGCTTCCGCGTGGCGGTCGCCACAGCGGGAGGCGGGCGCTCGGTTCGAGGTGGTGAACTCGCC
ACCTCAGAATCCCCTTTCGCTTCCTGCGGGGGATCAGAAGCCTGAGGGTCGTGGTAGCGCTTCAGACGACCCACATAAAACGTCGGGTGGGTCGTCATCG
ACTTAGGCAAGTCGATCGTGTAGGCGGAGCCATGCCTGCTCAGGACCTCAAAGGGTCCGATAAACCTGTGCTTCAGCTTATTGCTGAGCACGGAACTGAC
CGAGTTTAGTGGTAGGTTCCTAGTGTCGAGTAAGACTAACTCGCCCACTTTAAACACGTTTAAGTTTCCTCTTCCATGTCGGTCAGAGTACTCTTTTGTT
TATCTTGGGCGGCGGCCATTGTGTCGCGCACCCGGCTTATCACATTAAGCCTGTTGTCGACAAAAGTCGACAACTGCTTCTTTAGGGAAGCCGGTGTCAC
GTCTGACACCTGGGAGGAAAGAGCTTTCCGAGCCTCTCCCCCACTTACGACCGAAGCCGCGGTGTCACCACGGAGAGTGAGTGGCACCAGGGGTTCCGGA
GCCCGTTGAGGTAGAACGGGGAGAACCCCGTGGACGCGTGTACCGCGTTGTTGAGTGCAAACTCAACCATCGGCAAACTGGCCGACCATGTGCCGGGAGA
TTCGGCACAGACACTCTTCGAGGACGCGATTGACGCGCTCCGTCTGGCCGTCCGTTTGCGGGCGGTCGGCCGTGGACATGAGCAGCCGTGTTCCAAGCAA
TTGGAACAGCGTTTTCCAAAACGCAGACGTGAACCGTGGGTCACGGTCAGAGACAATAGTCTCAGGGAGGCCATGATAGCGGAAGACGCCATCCAGGAAC
AGCCGTGCAGTCTGTTCACCGGTGACTGAGTCAGCCACCGGAGCAAGGTGTACCATCTTGCTCAAGCGGCAGACAAACACCAGGACGCCGGTGTTGCCCT
GGGCATTAGCCGGCAGTCCGAAGACGAAGTCAAGACTCATCGACTTCCAGCAGTCTTCCGGGACTGGCAGGCTCTGCAAAGGAGCCGAGGCATGACCAGC
AGGTTTCACTCGCTGGCATGTCTCGCAGGTCCTTACATACGTGGCGACCCACTTGTACATGTGGGCCCACCAGAAGACCTGGGAGACTGACAAGAAGGTC
TTTTCGCGGCCAAGGTGGCCGCTGGAAGGCACATCATGCGCCTCCTGAAGTATGTCATACTTCAGATCCTCGTCGTTGGGGACGACTATCCGCGGAGGAT
CGGCCGGATCCACGCGGTAGTGGAGGAGGCCATCGACCCACGCATAGCGATGGAGGCGGGCACGATGGCGGGGCGTTAGCCATGCATGCTTGGCCTCCTT
GCCAGCGGTGAGGAACCGCACGATGGGGAGAGATTCTCATCATCTCGATACGCTAGCCGTATCCGATCGTACAGATCTGTCGTAACCCGACTAATGTGCG
CGAGCTCATAGTCGGGTCGACGGGATAACGCGTCGGCAAGCACGTTCAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTATATTCCGCGAAGAATGACAG
CCAGCGGGCCATCCTCTGAGACAGATGCGGAGAGTTGGTGGCCGTCCGCAAGGACGCGTGGTCTGTATAGATCACAAAGGGCTCAGAGCCCAGGAGGTGT
ACCCGGAACTTGACAAGGGCATACTTCATTGCGAGGAGCTCCTTGTCATGGACAGGGTAGTTCCTCTCGGCGGCTTTAAGCTGCCTGGACTGGAACGAGA
TGACTCGCTCGTGCCTCCGCGTCGTGTTGCAGCAGCGCGCAACCGATGGCATAGTCGGAGGCGTCGCAGACAACGCTGAACGGTTTTGTCTCGTCCGGCA
AAGCCAGGACCGGCGCGCGCTGCAAGCTCGCCTTGATGCTGTTGAATGCATCCTGATGACGGCTCTCCCAGCGCCAGTCGGCATCCTTCTTAAGGAGATC
CGACAGGGGTCGTGCCAGCCCGGCATACCCCGCACTATACTTGTGCAAGTAGTTGGCGAGACCCAACCACTTGCGAAGATCCTTTTGGGATCGTGGTGTG
GGCCAGGCCGCAATGGCCTTGACCTTCTCAGGGTCGGCTCGAACGCCGACGCTGCTGACGAAGCAGCCGAGAACTTTGATCTCTTGTGCCGCAAAGACGC
ACTTGTCGATGTTGGCATAGAGCTTGTTTGCTCTCATGACCATAAACACTCGACGGAGGTGCTCGAGATGCACCTCGATAGCCGTCTTGCCTTCCCCGGC
ACGGCTATGGACGAAGATATCGTCAAAGTACGTCTGCGTGAACGCACGCAAGGGTCTAAACAACTGTGTGACCAAGCGATTGAAAGTCGCTGGGGCATTT
GATAGGCCCTGTGGCATCACTAGCCACTCCCAGAGCATGCCGCTCGGGGTGCTCACCGCCGTGAGCGGGATGTCGCGCTCGCGCATCAGGATCTGGTAGT
ATCCATCCACCAGATCCAGCGCGCTATAAAGCTCGCAGCCCGCCATGTTGTTCAACAACACATCCTTGCGGGGAATGGGTGTCTGGGCGGGCACCGTTGC
GCTGTTCAGCTTGTTATAAGCATGAACCAGACGCCACTTCCCGTTCGGCTTGCGAACGCAGAAGGTGGGCGTCGAGTGCGGAGACTTCGACTCACGCACC
ATGCCTGCCTTTGCCTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTGTTCGCGAGGCAGTGGCCATTGCCTGGTCACACAGTACTTTGTGCCTGGCA
CGAGATCAATCTCGTGCCTAACTCCTCGGTCAGGTGGGAGTTGGGACGGCGGGTCCTTGGACACCACGTCCGAGAACTCCTTCACCAAAGGATACACTGG
ATCCTTGGGGTTCTCGAGGATCGCAGAGCCCGTGCGCGTTGCGCGCTTCTTGCCAAGCTCGTCCAGGACATCCTTGTCCATAACGGAAGAGGAGCTCAGC
TCTTCTGGAGAGGCCTCCGGCTTCAGGAGCACCATCTCCGCGATTGCCTCGGCTTTCAGTTGTGCCAGGAAATCGTCCATCGACATTTCCTCGAGGTTCA
GTAGCTCTGACACCTCAGGCAGGGCTGCCAACGTTGTGGAGCCCGCCTTGACCGTACACCCGGTCTCGCCGTCGAAGAAGTGATAGCATTCTTCGGCCGG
CCGTGCCTGAGGAGAGTTCTCTCTCTCCGAGTCGCTTGTAGCGACTCCAGTCTGTCTCACCAGACTCGGCTTACGGCGGCGACGACGTCGTCGATGCCCA
CCACGGCATGGTCCTTTGTTACCCACAGCCGGTGGTGACTCAAGGGTGGAGTCGGGAGTTCCATCGACTCCGTGTGGCACATTGTTACCCACACCAGAGG
TGCTCCCAGCAACCTCGACCCTGGCCACGGTCTCGACCTCCTTGGTCTCACGTGGGCTCGTTTCCCTTGGGGAGTTGACTTTCCCCGGCGTCGATAAGGC
CGAAGGCCGTACGGTGCCATAGTCAGGAGCGGTGGGTACTGCTGGCATTGCAGTTCCCCTCGCTGGACTCGACGTCCTGTCCACCGGCATTGCCTGTGGC
GGTCCGTTGCCCGCGTGGACGGTGTCATGACACCTGTTGCGGCTCCTGCCGCAACTAATTCTTCGGAGTCATTTCCGACTCGGCTCCGGTGGTAGGCCCG
GCTGCTGACAGAGGTGGGAACATGACTCACCAATGCTCTGTCAGTAGCAGCAGGCCGGCTAGCCCCGATGGCTTTGCCGCGCCAGTCTATCCAGGGCTCA
TGCTTCTCAAGCCATGGCATGCCCAGGATCAAGTCGTACTTGTCCATATCAAGAACGAGGAATCGTTCAGTGGAATTAAAGTCCTCAAACTTGACGGACA
GGTCCATAAAGACCTTGGGCACCTCCACTACAGTCCCGTCAGCCAGTCTGACTAGGACATGCCCGTTCCCTTTACTTTCTCGTAAAGCATCGGTGAACTG
GTCGCTCTTGCGAGCGACCGTCCGGCGGCGTGCAAAGTTCTTTGACGCCCCAGAATCGATCAAGATTCTCATGGGATGATCGTATCCCCGTACACTTGCA
TGTACTACAAGCAGCCCTCCGCTGCCCTTCTCCGCTTCGAGAGTACAGAGACTCTCAGGGGCTAAGCCTTCATGGTGCGCACCACCCGCGCACCACTCAT
GAAGACTTAGATCTTCCCCAGTAGGGCGCCCCGCCCCTACTGGTTCCCTGCGTTCCCCTGGCCACGGGGTCGCGGCTTTTGCCAGCGACCCCTAGGACCA
AAGGGCTTGGGAGGAAACCGCCGTGTTGTTCCTCCCGCGGGGCACGCACGTTTCATGTGCCCCAGTTTGCCACAGCCGAAACAGCGAATGTCGTGCTGTT
CGGCAAGGCTCAGGTCCATCGGCACAGGACCGTTGAAGGGGCCTCTACTTTGGGGCCCGCCCTGAGTGGAGCCCCAAGCCACGCAGTGGCAGGAGTGCGA
GCCTGTCGATGGCTGTACTCCTCCTGAAGAGCGATTTGAATCGCTTCTTCCAGGGTGCTTGCTTGCACCCGAAACAGCTGCGTGCGCGCTGGGCCTACTC
GCAGGCCGTCCATGAACACCGTCACCTTGATGTGTTCATGGAGTGGGTTTCCCACCAGAGATGCGGTGAGCTCCCGCATCTCCTGGATGTACTCGTGCAG
CTCACGTCTCCCTTGCTTGCACGCAAGGAAGCGTGAGCGCTGGCGATACTCATAGTTCGCCGGGAGGAAGGCGGCTCGAAGCTGTTCACACAGCTGAGCC
CAGGATGCAAAGCATCCAGGCGTTGTCGCTTCACGCGTATACGCCCAGCTCTTTGCTCGACCACTAAGGTGAGAGAGAGCAAAAGCGACGCGGAGTCGCT
CGTCCGAGACGAGAGCCGCGTCCATAGCGAGCTCGACCTCTCGGACCCAGAAGTGAAGGTTTTCCCCTTCCTTCCCTTCGTAGGGGTTAACCTTCAGCCT
CAAAGGCTTGGGCTGAACTGGTTTCCGTTCAGCCACAGGGGCCTGTAGGCTCCCACGTACATGGGCGATTAGCCCTTGCTCGTACGTGTCGAAAGCGCTT
ACGCGCTCGAGCTGCTCGGCAGGTGTTGCTGCCGCCAAGCTCTGGAGGGCATCCATCCCGAAGATGCCCGCCATCTTCCGAACGGACTCGAACTGCGAGT
CGTTCAAGTGAGGAAACTCACTGCGATCCATGGTGGCTCAATGCTTGAGACCACAGAGGATTCAGGTAGTCCAATCTTACCCGCGTAGGCGAGGATTGAC
TACAAGTGCTACCAAGTGTGACGGGAGTCACACAGCACCTTGCGCTCGAGGAAG