Description :
From Genome Similarity Track
Location :
Scaffold_18:435520- 444934
Transcript NameFunction/comments
Phyca_LT153437194PREDICTED: kinesin family member 4 isoform 2 putati
Phyca_LT1534506229Hypothetical protein
Phyca_LT1534545551Ubiquitin carboxyl-terminal hydrolase 47, partial
Phyca_LT153452733523S rRNA methyltransferase
Phyca_LT1534506231serine hydrolase (FSH1)-like protein, putative
Phyca_LT1534506234Hypothetical protein

Sequence
9414 bases(100 bases per row)
agagcaacgacgtgcaggtggctgtgcgcgtgcggccattgagtgcgacagagaaggatcaaggctcggaggcgtgtgttcatgtcgtagactccagtgt
tgtattagctgagaagcagttcgactttgaggcggcgtttccagccacaacgcagcaggtatgggaggagtgcatttcttttaatgtagctttgttttga
tccattgcaattgatgtaggaaacagtatactcaaagttggtgtcaccaatgcttgacaagttcttcgatggctataacgccacggtcttcgcctatgga
cagacaggatccggcaagacgtgagtacactacggggaagattgggttattggtggttcgttaacgttgttggttttaaagatatacaatgggcaatgag
ttcaatgccaatgtcgcttcgactgagctaggtatcatcccacgcgttattgaaaaggtaattttgctgattgttatgctgggtgttgagtttcaaatta
acaacttttgttctgcacagatttttaagcgggttacttcatcgccaaacccacagcatttcctgattaaggtgtcctacttagaggtacgtagttacag
cttgtgacatcgctcttcgccgttaactcagctctgaccgtagatcctgaacgaagaaattcacgacctgctcgcacaaccaacgcctgaatcgctgcag
gtcagcacggggctatctatacgtggtgatggagatcgtggaattgttgtggtagggcttagtgaacacactgtggactcaacggaacaagctggcgaac
tcttgcgagctggagctttagcacgcgctacagcttcgaccggcatgaacgctcagtccagtcgttcgcacgctatttgcaccattgccatggagcacca
tgatgtccgaaccgtagaaggaggcacggaaacgcggttttcaaagtttcacttggtggatttggcggggtctgagcgtgtccgacgcaccaattcggaa
ggagcacgctttaaagagggtgtcaatattaatcgtgggttgctcgcgctgggaaatgttataaacgcgttatgtgaacgtcgtcgcaccagttcgtccg
catctcatacaccctaccgagactcaaagctgacacgtttgctccaggatagtctgggtgggaacagtaagacactaatgatcgcgtgcgtcagcccggc
cgacgtcaactacgaagagacctcaaatacactgcggtatgcatctcgagcgcggaacattgaaaaccaggctgtgatcaacaaggaacgaagcgctgaa
aacgaggtgctttaccttaaacagcaagtcaagatcctacagctgcaactcctccagcaaacgcaagacaaggaaagtggccggatcaaggcaagcgacc
atcgtccgatcaatgtggaacaggataatcgcaggcataaagaacttcgaggagcaacggacacgaggggaaaaaaagcgagtgagctggtggacaacaa
caaagacgtgaatggagaaacaaaggcattaacggacaacctaccgtcaatatcgacaccgaaagctaatgagaacggtaagggagacatggctctttca
cggctggagcaacttcggatatttcaaagccagaaactgaaatctatcaacacaaaggcaaatcctgctgtgaaccgtcgaactgacggcaccacggtgc
cgagcaagcgcagccggacgctaatgccaccaactactccagacattcgaagaacaagctcgagtgtgaggactccagatactaaaggcacgattgaatc
aaatgctttctccattgcaaccacgacaaagctgttgcaacaagtaatggcgtctcgggaggcgatttctagcgcgaaggaggcagtccaaacaaacgtt
gcggataggaaagctttggcgattgcgatttcacggtttaaagctctgccgtcgattgaaagtgcggagacgctagctaagttgcaggatgaacttcgta
aaaagacggatagtatccgtattctgcagcagcaactggccagcatcgaggaaacgatgtcactaccctctggtctttttcctactaggatcgaaatctg
tcatgacctgattcgtcatttgatccaagcactggttgaaagcaaggaagagtgtacaaactgccaggtggaacttaaagcctcaaatgagcagatcgag
aaattaacgaaagagttgcagaagcaaacgacaaagaggaaggcagcaaagaagcgaaagcagcgacagtcatatgaaacgatggagaccctgttcagca
gcagcgatgaagaagaggacaacagcgctgactccgattacgtggatgaagaggaccgtcgtgcaagacgaaccaaacgaaaaagaggggctagtatacc
ttcaaatggtggtgatcctatggatgaaattaacgagttgctggaaaccagtgcagctacctgctgctcttgtcacggtaaatgtgcaacaaaggcatgc
gtttgtaagtcgcaaagtcgaatctgtagcaaagagtgctcgtgcaattcacaaaaatgccagaatcaaggaaatgctgccccacctgctgatggtgatt
ctacaagtgaaagccagaaaaatggcgagactactgatgaaatggttggacggaatgacacaaaagcttttgatgcggcagcttaatgtaatacagtcgg
gcttgacgaagttttaaatcatgtatttagtgtttttaccacttcggatgagcacttcgtttacttgacagacgagctgaagctttatgacaagccctcg
aagaggtccatgtctaaagcttccgtcttttctgtcatgaagtcggcgtcgtcctcgtcgtccgtgtcggaggaggcatgatgacgcgccgcggtctttt
cagcacggcgagtcggtgtgcggatgctgacaccgttcgagtttttgccgttgctgctccctacgcttccagctcccttgtgctcactcgtccttgatcg
cgttcggatgaccagtgcagcttccttgggtttctggtactggtaagcgttactactactggaagagtacttcgcacgcagcgctcgggtcttctcttca
ctcttcttcgccaagaagccctggatgagctggcgctcgtgattgtgcatgtatgtcagttgcacactcgtgtcaatcaccaggaaaagctcctggtatt
cagattcctggcgtgtgaaagcagaagcgggcgagaaagcatacgaaaccacttcgaggatatcgatggagtcacgatgatacggaatacgcgcaaaggc
caaacgctctgcgggaatggagagggcagcactggcagcatcctccagataggtgttagggtgtttttcttcttctgaagtgggaatgatcacctcatgc
cgcatgttcttgacaaaacgccacgtcgcacgatttacataggcaaattcaacgattcggtggttaacctctgacgtctcaggctcagacaagagctcag
ccacaatgctccttccttcatacacagccaacttagatgcttcaacaagcttttgcccatccaccagcacactcgtcatcgtactttggcgcagatcacg
caagcggatgtgagatggagttatcttgccgtcttcaggttgcacgagcttcttttccaccaactctgcccacacctttcttcgaatatcctcgaccagc
atttcttcgctgatcaccacttggctcacgaatgtcagcaacgagtcgtcctttccagttgacactaacacctcatcaatgtcaaattgatcatctgcat
tcataacagtaggttggtcctggttgccatcgttctcaggagaagccgaatctgcttcggtcgagttatagaacatcagtcggaagttgtactcgccggt
gttcaatggcgtcccctccagagcgaagacagtatggttcgagccaatcgacagcttcgatagagtgctgtctatcgccttaatttccacgccagcactg
tttatgccacgtaacagcttaaatttgtcagaaggaagaccaatcttggcactaacttgttccttaagagcgcggatcgtctccctccggtcaatgcgaa
taggctccgctgggctggtcaaatacttgaagtttaccgtgatcatgttcgcttcacgctcgaaaaacgcctcagcaggcgaaggaagtgtcatatcagc
agtttcttcgaaatacaactccgttccattgaccaggtgcaaatccatcttcagccgcaggtttagcgtccgttcttcatcatttgcattgagaatcttg
gctgcagctatgctgtatgtagttgcgctcttcttaatgaggcgaatcttacgaccagctgcaatcgagaacttctttgcgatcacagcgcacaacgctg
caacatttgcatcgtcatccacttgaacgcatcttgccacaaaagagtgttgactggtacagtctgcctctggatcgacaaagcgacgaataaaaagctg
tagctttgtcggatcgtgctcttcccattcttcgtcgggacttttcacctcgaggaacatctgatgaccaccgtatactcccagcgacgatagagtcata
tcctccttgtcgtcataagtgtcagacaacagacagttgtagtcattgtagcctcgcaatctcacattctctatcgacgggataatggcatccttatcct
ttgcgaattccttgtaggctgcttcgagtgcttcccggatagttgcagtcttgtagatgtggatagccttctctatgtttttcggcttggatcccttcat
gaaaaacttcacttgcaccttctttgccatctcgattcgctcctgctccagcctacgaatcttttcctcatcagcgtggatcctgtctttcaaatactgc
ggaatgctctccggcaaaatcacgttaacattcttgtcagcgttaaccaaacgatacagcagcatgtacgcgcaagtactgtagcgcatgctgtatcctg
aaccacttgctcctccgaatgcagtcttcagttcggtgtctgaaatctcgctcacagtggagtcattaaagttgtaccatttgccagactctagagattt
aatgtacgcgtagtagtggccacccagtgcactgcccgaatgaatcagaaccgagtacagctcatacacgtgaggccctgaccgcttgatcatgacctcc
gggtcaaaagttgggctccacgtgtcaaatgtagcggttccgtctagatcgtcttcctcatcgtccacgttaatttcatctttcacgaaggtcacaggct
gcgactcatccatcgaggagaggcgacgcatacgttcgcctaaagctaatagtcccggtgtcggaggaggcgaagcagatgtagctggcattgcatcctc
ctgggaaatgtggtggtttttaccttccagttcgtgacgctccattgacatttttcttgcaattttaccacgaacaccgccgttttcgtcactcacgtac
gaattcatgtccagatacttgggaaacgtcaccttattgtgtaatttgatgcgattcatggtggcgtagtcaaaatcaaagcgtttaagctgcaacatca
aaatgtacggcagcttggaaaacttgagtcccttaattgcgtctcgtttcaccttgcacttgtcacacatccactggttctccttgttcaacacttccgg
cctcaaaaacagttcaattgcctcctccaccgtcttcatcatctccgtggagccaaaggggcgaataaccagcgacaagtccaaaaaattgtcaattctc
gagctttcatagccacattgacagcactgcacgtagtccttcaacgatccttggtacaggtcattcacgagtgtctcgttcactgtgcctttaaacgttt
tctccaaagcgtctagaagaactctacagagctcctgaacatcatgttgctggaagacgtcagctcctgtccatccaaagctcttggtcaatgcttcagt
agaaatagaggtttgtgtcgtcagctgcaacttggcgaaaaggttctgcagttgcaacgggatattatcttcatctgcctcctcttcttcttcttctttg
tcctcctcctcagccttcttaacagctccgtgacacgtccaattgtacagtccctggcggaactcaggcgtcatgaacatgctctgcagcaggctgttca
tgtagcacgtagccccttgattggacaaacccgtaaaggcttttctagagaaactgtagcctccagaactgccgtagctgctgcccccattgctagtgta
tcctggagagtcgtatagaccctccagacctgaagaactgtacgtcgtaagcgctgtggactgcacgctgtgacttgtagcactgtcgtcttctgcgcga
ggcaattgtgtcaatacgttcgccacctgcgctcgatgctggtcacgagaggctgagagatcgtcatcgtcactcgactcccagcctgaaggcgccggtt
gatatttacctccagaatttgatgcagtccagtcattctcccaattcgagacagacgttgagggctttggctccgtctgataagtcacagacgcagacgc
tctgtcgtcatcgttcgagtctctggccgaggctatagaagacgtagacggatctgtacgctgtacaggccttccgtcgctcatacttacttatcactag
agggaatgagatctatcgagagggtagatgttgtggtgtgtcgtacatcaaaaacagagtgatgagaaaaacttgctggtacgaagaaatacagtcatgc
aaaacagtttgtggattttagatatcatcgctgagtagttcgagagtctacaccatacggggcgtgggtgacatgttctttgcgagtggcaattcttcgt
cagagtcttctgagccgtagtacgcacggtcgcgtttgagagtgaaggtgtcagagaggaagtccagttcacccgcacggagtttctctttccgccacat
cgtgtagcaaaagaccattgcaacagcgtacagcatagctaaaacggataacaaatatagaatttatcaagaaggcacacagacagtaataaaacaacgc
acagattaaaagttgtgcaacaatcaacctgcatggatttatgcttctctgctgtaacgacgtacctgcttcaaaacacgaattggcgccggaattggga
gacttggcattgaggatgtacatcggctgcagcttcagcagcgatcccacaactacctgcaaatacacacataataaataccaaaaacaacattaacaac
tgtaacatgtcgccgcagagagaggtggtggcacatcagagtgcataccaagaagacaaagccaacgaagctgaagatggtgccgcataaataacctata
gggggtaagtcaggcatcaaacgtcagggaaaaagcaggagaatgggcccagagcttcgtattgcgcctgaaaccacgcacctcctccactcatggcggt
ctaatgtcggtgtactgtgtcctcttcctcctctactgaattggcgtcaattccttccgcccctaggattattgaccaatcaaacgtagtgccatagata
ttttccgctgatacgacgtttgattggtcagttatcaaagatgatgtataaagtcagatgtgtctcacaccatttcagtgtgttttctatattagtgtgg
cagacaccaatcaatttttgctagttgaattgaagtctacgatttgttttgcagtcttcaattgctggtgttgctgtcatgggtgccgccaggaaactgc
gtgtgctgtgcatgcacggataccgcaccaatgctaagatcatcgaagaccaaacgcgtggattacgtaaggctttggcgccacacgccgagtttatctt
cctgaacggccccatcaaggcccgcggaccgtcagacgatgtgattgaaaagctgtacgccgatcacaagccgttctatgagtggggaagcttcaccgag
cgtgagaggccgcaccgcctagacccagagtcccaagagatcgagtatctcgacggtggttggtatcacgactacgtggactgggacaacacggtcaagt
acatggacgaacagctcccgaaactcggacctattgacgccgttgtgggtttctctcagggtgcacagacgatgacggcgctaacaatgtggtacttgca
ccaccacaacaagcgctggtggaactgctgtgtgagtgtctgcggtccacgtgtgcgtggggcggcactgcgacctctgttcgagaatcccgatgggaca
aagaagctagtgccaatgccgtcgatccacatcattggtaagacggacaagtggcgcagcggctgctacgaaatggttgacatgtacgaggaccacccca
agggagcagcgcgtgacaaatacgtctttgaacacgataccggacaccggttcccgactggagagcggcacaaactgctatacgacgaagtggcacagat
cattcgctcacactgcgagtttcatgctgcaaacgagcggatcgcatgaggtaggaacaaacggatcgcacggggtacagtactgtagacttatcaaagt
aaacataacagtgtttctgtctgcgctcatcaccacaacttgaagaaggcgttcactttcacgtcaaacgcaaggaggttctttagttctcgatttgcag
acaaagtggcattgctgctctactgtggactccacagtgtggagcatgacggtcatagcgaagaaactacgcattctctgtcttcatgggtatcgcacca
acgtgaaagtgatgcaagatcaaacgcaagatctgcgtcgcgtcatggcccctcacgcggactttgtgttcgctacagctccgtttaaggcccgcgggcc
tcccgacgaggtgattgagcagcgatcatggcccattctatgagtggggccacattacgagctcgcgagcatgacggcggtgacaacgggtggtatcacc
aatacgttgggttcgaccgggtcgtgaaacacatcgacacacaaattcaaaatcatggaccattcgacgccgctatcgggttttcacagggtgggcaaat
gctcacagccttgacgatgtggtacttacaccagcgcaatgaaaattactggaaatgttgcctcatttgttccggaacccgcgtgcgagacgttagtttg
cgtccagaagccagtaccgatcccttcaatccatctcattggcaagaaagatcagttcttcaagacttgtagcgaacattccaagctgtacgcggacagt
cctaacaaatgggtcatcgagcacgacagcggtcaccgcttcccctctggaagtcgctaccccggtctatatgagaagatatccgacaagattcggcagc
actgcaacaattga