Description :
From Genome Similarity Track
Location :
Scaffold_245:4355- 5633
Sequence
1278 bases(100 bases per row)
AGACACGTGCCTTGCGAGGCATCTCTGATCGTTGATCGTTAAGAGTTAGCAACATCTCCCTGGTAGCTACTCTTGAGCACTAAGTGCTGTAGATTCACTG
AATCGTTCGGTTCCCTGGAACAGGGACCTTAAGCGTTACGCTTGTTGACTCATAGAGATTAGTTCTTTAGAACTAATAACGCTCTTTGAGCACTAAGTCT
TCCTCTGACTTAAGGAGCTGTGTCGCTCCGCTACAAGCGACGTGTAGCTTCACGAGTACCGGCACTAAAGACGTATTCATATCCAGAGAAGACGGAAAAG
TGATCGATACGGGAGCAAGTTCATCAGTCTGATTTATTCGGGTAGTCGTCGATCAAGCAACTTTCCATAGTACAACGACGAACGCCGCAAAGAGAAAGCG
GGGGAGGCACATGATGGGACCAGATATGGCTTTTTGACCTTCTGAGAATGATAGAAGCAATTTATTTGCAAACCCTTACGGCCGCGGCGTGTTATCTATT
GACGTTGACAACACACAAAAGTTGAACTCCGTACGTGAGACCAATGGAAATTATTTTCGTTTTGTTATAAAACCTAAAGATATATATCCGGTTAAGCTGA
TTTAATCTTGCGTGCTCTTCTTCTTGTGTCACTCGTGATAGTGACCGTCATATCAGCACGACGACGAACCGTCGCCTGATGTCCCACCTCCAACACTCCT
CGTCGACGACAAGCTGCCGATGTTGGCTCTGTCCACGAGAAATTGATTTTTCCCGTCAAAATAGACTTAGTCTGGAAATCAACTAGTTGTAACTTGGTTT
CATTATACTGCAGCTGAATGACCTTGTTCTCGACTTGATCACGTACAAAATGATAGCGTATATCAATGTGCTTCGTACGACTTTGATACCTATCATTTTT
CGCAATTGCAATAGCACTTTGATTATCCTCGCATACAACGACTGGACCATCAATATAGACCTTCATCTCCAGCAATAGACTCTCTGAACACAACACTTAC
TGAATACACAATGAAAGTGCCACATCTTCGACTTCCGCAGTACTTAGACACACTGTGTTGTGGTTTCGACTTGAAAATGACTAGGGAATCTTTATCAATA
CCAGGCGCCTGATGTTGAACGTCGATTGTCCTTGTTACTTCTCCATTCAGCATCACTATAAATACTATACGTCGATTGTCCTTTGTTACTATTTCCCCAG
TAAGCATCACTATACACTCATTATTTAGCACACCAGGCTTGCTCCGATAGCAAATTACACTTGTTAGTCCGACTTAAG