Description :
From Genome Similarity Track
Location :
contig_10:43543- 49500
Transcript NameFunction/comments
g3420.t1hypothetical protein

Sequence
5957 bases(100 bases per row)
ACAGCCTTCGGGCAGTCAGCCTGGAGCCGCTCGATCGGCTCCCATGAGTTCTGTGACGAGGGATACCCTCGCCACTTCACCAAGAGCTGGCGCTTCCTTT
GGCGGCGCCGCTCACGGAGCACACGCTCCACGTGGTAGTGGGTTTCCCCATTACGGTCGAGGAGGGCCGGCGGAGGCCTTGCTCGACTATGCGTACGATG
CTCCGCCACAGCGTGAGGCTCCGAGATCGTCGGCGCGATCTCCCGATCGGTCCGTGCTGCTTCAGCAGCAGGAGATCCACGATCTCCGTGATCGAGTGTA
CACTCTGGAGATCGCATTGGGTCTCGGCCCTGGTGGGCAGGCTGCCGCTCAGTCGGGAAAGCCGGGGTCTCTTCCCCTCCTTCGTGGGGATGTGGACCGA
CTGAGCCAGGAGTGTGGGGATCTCCACTCCCGGGTCGATCGTCGTGCGTCGTCGTACGACGTCGACTGTCTTCGCGACGAGGTGGCTCACCTCCGTTTGA
GATCCAGAACCGGCCGAGCTATCCGGGCTATCGGGAGCCGCAGTCCTATGCGTACTCCCAGCCGTACTACGGTTCCTACCCGTACGGCGGGGCGTCTTCG
AGGTCACAGGCTTACGCCTACGACCAGTCCCCTGCGCCGGCTTCCGCGTGGCGGTCGCCACAGCGGGAGGCGGGCGCTCGGTTCGAGGTGGTGAACTCGC
CACCTCAGAATCCCCTTTCGCTTCCTGCGGGGGATCAGAAGCCTGAGGGTCGTGGTAGCGCTTCAGACGACCCACATAAAACGTCGGGTGGGTCGTCATC
GACTTAGGCAAGTCGATCGTGTAGGCGGAGCCATGCCTGCTCAGGACCTCAAAGGGTCCGATAAACCTGTGCTTCAGCTTATTGCTGAGCACGGAACTGA
CCGAGTTTAGTGGTAGGTTCCTAGTGTCGAGTAAGACTAACTCGCCCACTTTAAACACGTTTAAGTTTCCTCTTCCATGTCGGTCAGAGTACTCCTTTTG
TTTATCTTGGGCGGCGGCCATTGTGTCGCGCACCCGGCTTATCACATTAAGCCTGTTGTCGACAAAAGTCGACAACTGCTTCTTTAGGGAAGCCGGTGTC
ACGTCTGACACCTGGGAGGAAAGAGCTTTCCGAGCCTCTCCCCCACTTACGACCGAAGCCGCGGTGTCACCACGGAGAGTGAGTGGCACCAGGGGTTCCG
GAGCCCGTTGAGGTAGAACGGGGAGAACCCCGTGGACGCGTGTACCGCGTTGTTGAGTGCAAACTCAACCATCGGCAAACTGGCCGACCATGTGCCGGGA
GATTCGGCACAGACATGTCTTCGAGGACGCGATTGACGCGCTCCGTCTGGCCGTCCGTTTGCGGGTGGTCGGCCGTGGACATGAGCTGACGCGTTCCAAG
CAATTCGAACAGCGTTTTCCAAAACGCAGACGTGAACCGTGGGTCACGGTCAGAGACAATAGTCTCAGGGAGGCCATGATAGCGGAAGACGCCATCCAGG
AACAGCCGTGCAGTCTGTTCACCGGTGACTGAGTCAGCCACCGGAGCAAGGTGTACCATCTTGCTCAAGCGGCAGACAAACACCAGGACGCCGGTGTTGC
CCTGGGCATCAGCCGGCAGTCCGAAGACGAAGTCAAGACTCATCGACTTCCAGCAGTCTTCCGGGACTGGCAGGCTCTGCAAAGGAGCCGAGGCATGACC
AGCAGGTTTCACTCGCTGGCATGTCTCGCAGGTCCTTACATACGTGGCGACCCACTTGTACATGTGGGCCCACCAGAAGACCTGGGAGACTGACAAGAAG
GTCTTTTCGCGGCCAAGGTGGCCGCTGGAAGGCACATCATGCGCCTCCTGAAGTATGTCATACTTCAGATCCTCGTCGTTGGGGACGACTATCCGCGGAG
GATCGGCCGGATCCACGCGGTAGTGGAGGAGGCCATCGACCCACGCATAGCGATGGAGGCGGGCACGATGGCGGGGCGTTAGCCATGCATGCTTGGCCTC
CTTGCCAGCGGTGAGGAACCGCACGATGGGGAGAGATTCTCATCATCTCGATACGCTAGCCGTATCCGATCGTACAGATCTGTCGTAACCCGACTAATGT
GCGCGAGCTCATAGTCGGGTCGACGGGATAACGCGTCGGCAAGCACGTTCAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTATATTCCGCGAAGAATGA
CAGCCAGCGGGCCATCCTCTGAGACAGATGCGGAGAGTTGGTGGCCGTCCGCAAGGACGCGTGGTCTGTATAGATCACAAAGGGCTCAGAGCCCAGGAGG
TGTACCCGGAACTTGACAAGGGCATACTTCATTGCGAGGAGCTCCTTGTCATGGACAGGGTAGTTCCTCTCGGCGGCTTTAAGCTGCCTGGACTGGAACG
AGATGACTCGCTCGTGCCTCCGCGTCGTGTTGCAGCAGCGCGCAACCGATGGCATAGTCGGAGGCGTCGCAGACAACGCTGAACGGTTTTGTCTCGTCCG
GCAAAGCCAGGACCGGCGCGCGCTGCAAGCTCGCCTTGATGCTGTTGAATGCATCCTGATGACGGCTCTCCCAGCGCCAGTCGGCATCCTTCTTAAGGAG
ATCCGACAGGGGTCGTGCCAGCCCGGCATACCCCGCACTATACTTGTGCAAGTAGTTGGCGAGACCCAACCACTTGCGAAGATCCTTTTGGGATCGTGGT
GTGGGCCAGGCCGCAATGGCCTTGACCTTCTCAGGGTCGGCTCGAACGCCGACGCTGCTGACGAAGCAGCCGAGAACTTTGATCTCTTGTGCCGCAAAGA
CGCACTTGTCGATGTTGGCATAGAGCTTGTTTGCTCTCATGACCATAAACACTCGACGGAGGTGCTCGAGATGCACCTCGATAGCCGTCTTGCCTTCCCC
GGCACGGCTATGGACGAAGATATCGTCAAAGTACGTCTGCGTGAACGCACGCAAGGGTCTAAACAACTGTGTGACCAAGCGATTGAAAGTCGCTGGGGCA
TTTGATAGGCCCTGTGGCATCACTAGCCACTCCCAGAGCATGCCGCTCGGGGTGCTCACCGCCGTGAGCGGGATGTCGCGCTCGCGCATCAGGATCTGGT
AGTATCCATCCACCAGATCCAGCGCGCTATAAAGCTCGCAGCCCGCCATGTTGTTCAACAACACATCCTTGCGGGGAATGGGTGTCTGGGCGGGCACCGT
TGCGCTGTTCAGCTTGTTATAAGCATGAACCAGACGCCACTTCCCGTTCGGCTTGCGAACGCAGAAGGTGGGCGTCGAGTGCGGAGACTTCGACTCACGC
ACCATGCCTGCCTTTGCCTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTGTTCGCGAGGCAGTGGCCATTGCCTGGTCACACAGTACTTTGTGCCTG
GCACGAGATCAATCTCGTGCCTAACTCCTCGGTCAGGTGGGAGTTGGGACGGCGGGTCCTTGGACACCACGTCCGAGAACTCCTTCACCAAAGGATACAC
TGGATCCTTGGGGTTCTCGAGGATCGCAGAGCCCGTGCGCGTTGCGCGCTTCTTGCCAAGCTCGTCCAGGACATCCTTGTCCATAACGGAAGAGGAGCTC
AGCTCTTCTGGAGAGGCCTCCGGCTTCAGGAGCACCATCTCCGCGATTGCCTCGGCTTTCAGTTGTGCCAGGAAATCGTCCATCGACATTTCCTCGAGGT
TCAGTAGCTCTGACACCTCAGGCAGGGCTGCCAACGTTGTGGAGCCCGCCTTGACCGTACACCCGGTCTCGCCGTCGAAGAAGTGATAGCATTCTTCGGC
CGGCCGTGCCTGAGGAGAGTTCTCTCTCTCCGAGTCGCTTGTAGCGACTCCAGTCTGTCTCACCAGACTCGGCTTACGGCGGCGACGACGTCGTCGATGC
CCACCACGGCATGGTCCTTTGTTACCCACAGCCGGTGGTGACTCAAGGGTGGAGTCGGGAGTTCCATCGACTCCGTGTGGCACATTGTTACCCACACCAG
AGGTGCTCCCAGCAACCTCGACCCTGGCCACGGTCTCGACCTCCTTGGTCTCACGTGGGCTCGTTTCCCTTGGGGAGTTGACTTTCCCCGGCGTCGATAA
GGCCGAAGGCCGTACGGTGCCATAGTCAGGAGCGGTGGGTACTGCTGGCATTGCAGTTCCCCTCGCTGGACTCGACGTCCTGTCCACCGGCATTGCCTGT
GGCGGTCCGTTGCCCGCGTGGACGGTGTCATGACACCTGTTGCGGCTCCTGCCGCAACTAATTCTTCGGAGTCATTTCCGACTCGGCTCCGGTGGTAGGC
CCGGCTGCTGACAGAGGTGGGAACATGACTCACCAATGCTCTGTCAGTAGCAGCAGGCCGGCTAGCCCCGATGGCTTTGCCGCGCCAGTCTATCCAGGGC
TCATGCTTCTCAAGCCATGGCATGCCCAGGATCAAGTCGTACTTGTCCATATCAAGAACGAGGAATCGTTCAGTGGAATTAAAGTCCTCAAACTTGACGG
ACAGGTCCATAAAGACCTTGGGCACCTCCACTACAGTCCCGTCAGCCAGTCTGACTAGGACATGCCCGTTCCCTTTACTTTCTCGTAAAGCATCGGTGAA
CTGGTCGCTCTTGCGAGCGACCGTCCGGCGGCGTGCAAAGTTCTTTGACGCCCCAGAATCGATCAAGATTCTCATGGGATGATCGTATCCCCGTACACTT
GCATGTACTACAAGCAGCCCTCCGCTGCCCTTCTCCGCTTCGAGAGTACAGAGACTCTCAGGGGCTAAGCCTTCATGGTGCGCACCACCCGCGCACCACT
CATGAAGACTTAGATCTTCCCCAGTAGGGCGCCCCGCCCCTACTGGTTCCCTGCGTTCCCCTGGCCACGGGGTCGCGGCTTTTGCCAGCGACCCCTAGGA
CCAAAGGGCTTGGGAGGAAACCGCCGTGTTGTTCCTCCCGCGGGGCACGCACGTTTCATGTGCCCCAGTTTGCCACAGCCGAAACAGCGAATGTCGTGCT
GTTCGGCAAGGCTCAGGTCCATCGGCACAGGACCGTTGAAGGGGCCTCTACTTTGGGGCCCGCCCTGAGTGGAGCCCCAAGCCACGCAGTGGCAGGAGTG
CGAGCCTGTCGATGGCTGTACTCCTCCTGAAGAGCGATTTGAATCGCTTCTTCCAGGGTGCTTGCTTGCACCCGAAACAGCTGCGTGCGCGCTGGGCCTA
CTCGCAGGCCGTCCATGAACACCGTCACCTTGATGTGTTCATGGAGTGGGTTTCCCACCAGAGATGCGGTGAGCTCCCGCATCTCCTGGATGTACTCGTG
CAGCTCACGTCTCCCTTGCTTGCACGCAAGGAAGCGTGAGCGCTGGCGATACTCATAGTTCGCCGGGAGGAAGGCGGCTCGAAGCTGTTCACACAGCTGA
GCCCAGGATGCAAAGCATCCAGGCGTTGTCGCTTCACGCGTATACGCCCAGCTCTTTGCTCGACCACTAAGGTGGGAGAGAGCAAAAGCGACGCGGAGTC
GCTCGTCCGAGACGAGAGCCGCGTCCATAGCGAGCTCGACCTCTCGGACCCAGAAGTGAAGGTTTTCCCCTTCCTTCCCTTCGTAGGGGTTAACCTTCAG
CCTCAAAGGCTTGGGCTGAACTGGTTTCCGTTCAGCCACAGGGGCCTGTAGGCTCCCACGTACATGGGCGATTAGCCCTTGCTCGTACGTGTCGAAAGCG
CTTACGCGCTCGAGCTGCTCGGCAGGTGTTGCTGCCGCCAAGCTCTGGAGGGCATCCATCCCGAAGATGCCCGCCATCTTCCGAACGGACTCGAACTGCG
AGTCGTTCAAGTGAGGAAACTCACTGCGATCCATGGTGGCTCAATGCTTGAGACCACAGAGGATTCAGGTAGTCCAATCTTACCCGCGTAGGCGAGGATT
GACTACAAGTGCTACCAAGTGTGACGGGAGTCACACAGCACCTTGCGCTCGAGGAAG