Description :
From Genome Similarity Track
Location :
Scaffold_3:435390- 436834
Transcript NameFunction/comments
Phypa_INRA-310PPTG_01305hypothetical protein

Sequence
1444 bases(100 bases per row)
AAGGCGTCCTTGTCACTGGCGTTGAACTTGTTGTTCTTGCTGCTCTTCTTCTTCGGAGACACGACCTTGGCAGGAGCAGCTTCAGCAGCAGGCTCAACGA
CCTTGCCAGCCTTCGGACGAGACGTCTGCTCGTTGAACCAGACCTTCTTGGTCTTCACAGCAGCCAAAGACTCCGAGACAGCAGCAGCAGATGCAGGAGG
CAGCAGGCCAATGGTGCTGAACGCCTCCATCTGAGCCAGAGGCAGCACCAGCTTGGACGCCTTCTTGGTCTTCTTGCCGTTGCGGCCCTTCTTGCCCTTC
TTGCCTCCTCCAAGCATCATAAAGTCCTCTTCCTTCCGCTGCAGAGGCTTCATACCGTCCAGCTCAAGAGGAGCGGCCGTGGTCTCAGCAGCCTTCTCGT
CCTGCTCCTCCTTGAGCTCCTTTGCGTACGTCTTCTCCAAGAAACTCACAAGGGCGTCACAGAGGTCCATCTCGTCCTGGTACGGGTGGATCTTGGCCAT
TTCCTTCTCGTAATCCGCCAGTTTGGCCTCGTACTCGGCCTTGCGAGCCTCCTCCTCCTTCTGACGCTCCAGCTCCTTCTTCTTACGCACAAGACGGATG
TTGTTGTAGTACTTGTCGTTGGCTTCCTTGAACTCCTTACGCAGAGTCTTAATAGCCGTAAATTTCTCGTCCAGCTGCTCCTTGATCTCCTTACGCTCCT
TAGCGAGCGCAGGGAACTTGTCCTTCTTGTTCTCCTCCTCGTTGAGACGGTAGAGCTCGTCCAGCGCCTGCTTCTGCTCGTTCAGCTTCTCCTGAATGGC
GTCAATCTCCTCGTTCTTCTTGGTCTGAAGCGCGCGAATCTCCTTGATGCTCTCGTTCTGCTTCTCCACGACTCCTTGGTCGTCCGAGAAGCCGCTGACC
TGCTGCTTCTGAGCTTGCAGCTGCTCGATCTCCTTGATCACGCGCTTCTCCTCGTTCAAAGACATGGAGCTGGTCTCCTGCTTGTGCTTAAGCTCGGCGA
TAGCAGCGTCGAACTCGGCAACAGAGCCGTACTTGAGGTTGGCACGCACACTGCGCTGCTGCTTGATAGTCGAGTCCTTCTCGTCGCGGGTCTGACGCAG
ACGGGCCGTGATCTGGTTGCGCTGCTGAAAAAGGTTGTCCTTCTCAGCACGCAGAGCCGCGAATTTGGCCTTGGCCTCCTGAATCTGGCCGCCGTAGCCG
CCGCGGTTCGTCTTGAGTGCATCCATCTCGGCGCGGATTACATTGGTGCGCGCCTGGAGCTTCTTAATGGCGCCATCTAGCGCAGAGATTTTGGCCTCAT
GCTCGGCCTTGTCGGGCTTGGGCAGACGCTCGATCACGTCCGGGATCTCCTGCTCCTCCACGGCGACGACCTCTTCGGTGCTCATCTTTACAACGGGTTT
GGTAGGTAGGTCACTCTATGCGGTGGAGGGGGGAGTTTGACTGG