Description :
From Genome Similarity Track
Location :
contig_25:435178- 437500
Transcript NameFunction/comments
g6161.t1hypothetical protein

Sequence
2322 bases(100 bases per row)
GGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGT
CGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGT
CGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCA
TGGTGTCTAAACACCATGTCGACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAA
CAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGA
TTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACGCGCTGGCATACCTCGCAAGTACGAACGTACTTGCGTACCCACTTGTACTGGTGACTCCAATAG
AAGTCACGCATGAGAAGCAATATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAGCTCATGATC
ATCCGGCACGACAATGCGATCTGTGTTGGCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTGTTTG
GCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAATACTCCAACAATTGCTTCGCATCCGCATCATGCGCGTATGTGGCCTTCACGTCATCTAACA
TGGACGACGAGAGTGTAGTCGTCGGCCTCTTGCACCTTCGTGATCGTGTTGCATCAATGCGCATCCGATCGCGAAATCGGATGCATCACACACAACGTGG
AATGGGCGATCTTGGTCGGTCACCGCCAAGATTGGCGCCTCAGTCAAGCCCTGCTTGACTGCTTCAAAGGCCTGCTGACAATCAGCAGTCCATTCCCATG
CAGCTTCTTTCTTCAAGAGCTGCGACAGCGGGCAATTCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAG
TTCCTTTACGTTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGT
ATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTGTGCATCTCCA
CATCCGATTTTCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCT
GTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCCGTGAGAGGGATATCACTC
TCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCATTTTGAGGTATCG
GCGTCTGCGCCGGTACCGTCGCATCGTTCAGCTTGTTATACGCATGAACGATGCGCCACCCCGCCCTGTGGCTTCTTGACACAGAACGTAGGCGCGCTGT
CCGGGGACTTCGATTCCCGCACTTGTCCTGCCTTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGT
GACGCAATACTTCGTTCCCGGCACGAGATCAATTCGTGCTGGACACCCTTGTCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTATT
CACGCAAGACCTTGTAAAAGGGTCTCGCCTTGAGCGAATCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCTCCCTC
AGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGAAGATCTGCTCGATGCGTCCATCGTGCAGGTCGCGAGCG
AAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCAACGCTAACGTCGGAGGGTTCTCCAGTCTCATCTTCTTGTATTGGAGACCAATGCTCGTAC
GCGTCAAGACACTCAATGTCTC