Description :
From Genome Similarity Track
Location :
Scaffold_1036:435- 2812
Sequence
2377 bases(100 bases per row)
CGGAAGATGAGCAAGTCTGCTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTTGGAGAAGGTATGGCGGTAATCCCGGAGGTACCACTGACCACCGA
GGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAACGAACCCACTGAAGTGGATCGTCTGCGTCAGAAGATCTGGGAAAGCCGACATCTGCTG
ATCGGTAAGGGTAATGCGTTACCGCCCGCCGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGG
CACCTCAGTTCCGAGAAAAACTGTCAGATCTGATTAAGGGCCTGCTGCAAGCCAGGATCATCAGCTTCTCAACGTCCCCGTGGGCGTCGCCGGTGGTAAT
CATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACGGCCTGACTCGATTGATGGTGTATCCGATGCCTCTGATCAAT
GAGCTGTTGGAAGATTTGGATAAAGCACTCTGGTACTGTTCTCTAGACATGGCCAGTGGTTTCTGGGTGGTTACTATGACGGATCGAGCTCGCGCAATAT
CCGCATTCATCACACCGTTTGGCCTGTTCGAGTGGACCCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGCCTCATCGATAACGCCCT
CTATGGGTTCACCCGAATACCGGAGCCCGAAACGGGTGGATCCGGGGAAGGTGACGCAGAAGTGAATCCATTCGAAGCGGGGGAGCCAAGGGATCCTGGG
ACCCCGTCTGTGTTAGGACGCAGATCTTACATCGACGACATTCTGATCCCGGCGGAATCGTGGGATCAGTTGTGCGAAAGAGTGACATCCCTACTGGAGG
CGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTTAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTGGGCCATCGAGTTTCCAAGGAGGGATTAGA
GGCGAATACTAAGGACCTGTCTTCATTAGCCGATTTGTCCTTCCCACAGTCGTTACGAGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGG
TTCATCGAAGATTACGCCCTGTTTGCCGCGGTGTTGTATGAATTAAGAGAGGTAGATTTTGCTGCGATGACCGCTCCAGCTGTCCAGATGAAAATCCAAC
GAGCTCTGGCCCGGGAGATGTCGGATCCACGAAGGGATCCAAGTGGTATGACGTCAGAAGAGGACCTAACACAGGAGCTGGATCCACTCCGAGACCAACA
GAGAGAGGATCCAGTCTGGATAGAGACGACGGATCAGAACTTGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAAC
AGGATCGCGACCACGCCTATCCTCCGTCATTTCGATCCGGAACGTCAACCTACGGTAATAGTTTATGCCAGTGACTGGGCAGTCTCAGCAGCTCTGGTGC
AAGAACATGAGGGGATATGTCATCCAGTCACCTTTGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTTGCGCT
CCTGCGCGTGTTGGATCTAAATTATAACCTGCTAGTGGGAAGATCCATCCGGATCCTAACTCGACACTCCACGCTAGCCTGGCTGTTCAAGTCGGCCGGG
TTGCAAGGACGTTTAGGACAGTGGGCAGCTTTACTCTCACCTTGGACGCTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGG
CCGCGAGCATCACTCCTCGAGCTAAGATGGATGAGGCGCTGACTAAGATCGCCCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGT
ACAGGTGGATGAGGATCTATACGTCCTGAGTTTCGATGGATCCGCTCGTGTACGACGCGGAGGAGGAGCATACAGTGCAATACTGTGGAGATTGCCCGGA
TGGGAAGTTGTACGGGCCAGATCCACTTACGCGGAAGGCCTCACCGTCAATGAAGCGGAGTATAACGGACTCCTTCTGGGTTTGGATTTACTAAAGGGAC
AAGATCCAAAACGGCTGGTGATTTGTGGGGATTCAAATTTGGTAATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACG
GCAGAAAGTGATGATCCACCTGCGTGGTTGGTTGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCGGATAGTTTGGCCAGTGCCGCT
TTACGGAATCAATGTGGTGTCGAAGTGGAGGGAGAAGCCGAACATCAGGATCTCGTTACGTTGAACCGACTTGACGA