Description :
From Genome Similarity Track
Location :
Scaffold_1827:4349- 6702
Transcript NameFunction/comments
Phyta_totarag13730hypothetical protein
Phyta_totarag13731SUMO protease, putative

Sequence
2353 bases(100 bases per row)
AAGGCGATTCGGTGGTATGACAAGCAAGGAGTCCACGTCTTAGCGACTTGTGGAAGTGCGAAGCAGGACAGGATTGTGCGGCGTGACCCCTCACAaacga
tgaagctgaactGATGGCTCCTAGAGTGGTGAAGGACTATCAGATGTACATGGGCGGCGTCGACGTGCATGaccaactgcgtcttcatAGGCAAATTAAC
TTATCGTGTATAAACCGCCTAAACAGATATGCTTATCGCGTCTGATACAATGTGTTGCTGTAGAcactcgctgcagctggccaGGCGCTACAGGAAATAT
TACAAGTCGCTATTCCTCAGCCTTATTGAAATGGTCATCATCAACGCATTCATTGTGTTCAACTGCCGTCGGGCCGTAGACGGGAAGCCGAAGATATATC
ACGTGCTGTTCTTGAatcagcttcatctggaGCGGTGTCAGCTGCAACCAGAGGGCTGACAACAACTGATGCACCACCGCGGACTGCAGCCGATACCGAC
GAAGACACGCCAAGCCTCTCGGTACGTACTGCTGCAAACGGCCGAGTGGCGGAAAGGCAGTGCAAACCAAGCTAGAAAGCGCCACCAGTCCACTTGTAAA
TCTGCTCGGTGCTCAAAGCGGATGGGGACGCGCGTGGGGGTGAGACGACGTTCTTCAGTGGTGAATGTAAGCTAAAAACGGCATCAAAACGTGCTCAGGC
AGCTCGTGTCTTCCTGTGCAACAAGGTGAAGAACTCAAGCAACGGCTTGCCAGTCTTATGCTTCGAAATCTGGCACAAACATTGGGAAAATGGCACATTG
ATTCAGTCGCGCAGCAAACACAAGATCCGCGCTCGGAAACCTGTGCAACCTActggtgatgatgatgatggtgGCGACGGTGATCTATCCAGCAGTGAAT
CCGGAAGTGACAGCTCCCACCAGCGCAAGCGCGCCCGTGGCGATGATGACGCCAACTAGTCGGACTTCTGGCTCTAAACTATCTTGCTTTGAATATACTG
CTGTGGTTGTGCATTGCCAGATGATCTGGAGCTCTAAATATTGACAAAATGATGGACCGTCTTCACTCTCGTCTATGGTGTTTTTGTGTTGTCTTTGTAC
TCGACACACACATTAACGACGATATCGTGTTTTCTGAGGACAGCTTTTCGTGTCAAATACACGATATCTCAGTTCTGGTTAGGCCGGGGTAGGGACAAGA
ACCGGCTTTGGCATAGACACGATAACTTTTATTTTGATTATATTATGAATGCCCATTTTTTCGGATAAACTTTAATGTATAGGTTTTCGGGAAATAGGCG
CAACCAAAACGTCTCGCAttgtggggggggggggtaatacatgtattgtgaaaaccggtcggaatgtctaatccgaatctaaatcagccgttgAAAAGTa
ttatttagagttgtatactcttTTAatattaatttcaatcgaagtgctattcaaagattactaccctcgattaaactccgaattgaaaggCGCTTAAGAT
AGGGCCAGTGATACAGCCCATGTTTTCTATAAGGGTTAGGTAAGTGGAATCCTGGACAATCTCCAGGTTTACCCAGGTTTCACTCATGTTTTCACTCAAA
GGTCCAGAATAAATTACGGATATCTTACGAGAGTGGTAATATATTATGTCTATGTTTGTGTTATGTTGAAACATGTCCAAAACATGTTGACAGAACGACA
TCAAAATGGAAGATTGATCGAGATTCTTAGCTGTCGGTCGGAGGTATCACTCTTATTTTGCATACACCGAACCTACCTCATGTAGTGTATCCATATCATG
CATCAATGGTTGACACATGGAAGCGTGGACGGACACTGGAAACATGGACAATAACTATGAACCATGCAAACATGTATTGATGCACTTAGTTGCGCTGCTT
ACTCGGTGGTCGTCTTATTGTCTTTGCTTGCGTCGCTGAAATTCACCACAGTCCGCAGAATATCCCACCGGCGGCGGGATAGACCTGTGGGCGTGTAGTC
GTTGCCGGCCGCCTTGAAGAAACGACGCCAAATGTATAAGCAGATGAACAGCCCGCAGTTGTCGCCGTCTTTCTGGATGGGGCTGTGCACAGGTGTTATC
TGGTAAGACTGCGCAAGGCTCTTCCTCGCAAGCTCATCGGCCAGCTCAGCAAGCAAGTTCTGGTTCGCCCGCTTGTCAAGACTATCGTAGCAGAAGATAG
GAGTCCTGGGTCGATCTACCACGAGACACGTCCAATGACTGCCGTTGATATTCGGCGGCATAAACACCAAATCCGTGTTAGCGTCTGATAACTAGCTCAG
CGTCCGGGGAGGGACGCGCTTGCCATTGTTAGGCGCTGGTGTTTTCATCGGCG