Description :
From Genome Similarity Track
Location :
Scaffold_85:43482- 44839
Transcript NameFunction/comments
Phypa_INRA-310PPTG_18521hypothetical protein

Sequence
1357 bases(100 bases per row)
CGGCACACCCCGCCATCATCGACATCATTAACTGTAGAAAAGTCATGGCAGTCCCGCAATACACCTCCATCACTTGGCAATATTGCTTATGCAGCTCCCC
CACAGCATTGGCGCAGAATACCTGCTGTCCAGCACTGTAGTCTGAGTTAATTCGAAGCAGTTTTAGCGTGCCCGAACTTGGGTACGACGTACCATTGTGC
GCTGTAGGTATCCGCTCCGCTCTCTTGCGGTGGTACCCACAGCGAATTTCCAGGGTCGAATCTCGGGTCACCCACGTGTTCCGTGTAGTTAAGCCAGAGT
CCCATGCCCTGCGAGTAGTAGACGGTGGAGTTGCGCTCACCCGACTGCGACAGCCAACGGGGCATGAGCGTGGTGTACCATGTGAGCGGTACTAACGTCA
CCGCCAGCAATACCACTGCAACAACAAGGTTAGATAAGGCGATGCAATGCTCTTGGCGGTCTGATAGCGGCGTACCCAAGAGCTGTAGCAAGTTCTTCAT
TGCGACTTGGAGCGCCGAATGGCAAGTGAGCTCAATGGATTTTGGTTGAAAACTGATATAGCCAATTACGACACCGAATGGCTAGTGCCACCGATTATGT
AGGCTTGCTTTTAGAAATTTATTTTAGTTGAATTGTACAATAATTGTGGCTCGACCATCGCAATATTGTTTTACTCAAAAAACAAATTAATCGCTTTATT
ACCCATTAATGAAAAAAAGGGACATGGATGGCATTCAGCCCGAAAAACCTTTCTTAGGCAATTTGTGATACCGGTATCTCACCGAAGAAACTGATATTGG
AAGGTATGCATTATCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN