Description :
From Genome Similarity Track
Location :
Scaffold_904:4348- 6076
Transcript NameFunction/comments
Phypl_g11559RIO kinase
Phypl_g11560hypothetical protein PHYSODRAFT_353557

Sequence
1728 bases(100 bases per row)
CGACTTcccgacgccgacgcctATTGACTGCAACCGTCATGCCATTTGCATGAGCCTTGTGGATGGCTACCCGCTCAACCAAGTGCGCCGTCTCGCCAAC
TCGAAGGATGCCTACGACACAGCGATGTCGATTGTTGTGCGACTGGCGGAGTATGGACTGGTGCACTGTGACTTCAACGAGTTCAACATTATGATCGGCG
ACGATGGCAAGATCACCATGATCGATTTCCCGCAGATGATCTCGACGTTGCACCCGAACGCTGCCGAGTGAGTGCAACTTGTCCTTTGTTGTGCATCTTC
AGGGTGGCGCGATGTCTGACGCTGTGCTTGCTTACAGACTGTTTGATCGCGATGTGCACGGACTCGTGAAGTTTTTCTCGCGGCTGCAAGGTGGCGCATA
CACGCCTGACGTAAGTTGTGTCACTGAAACTCCAACATAGTGTTGTTCTAACCGTTGGTGTGATTGCTGTGTATGACTCAAGCGCGTACCCAAGTTGCAG
GACATCGTGGCAGATGAAAACGTCCGATTGGACGAGGATGTGGAGGCCAGCGGCTTTGGCAAGGAGTTCGGCGAAAAAGTGCACGACGTAAGATACTGCT
TCATCAAGATATGTGGTGAAGCCAAAACTGATTGATGATTTTGTGCTTGTTTCCAACTGCAGCTCTCGATTTTCTCGGCTCACCAGAACATTGAGGAAAG
CGACAGTGATGGCGATGATTACGAGGATGAcagcgaagaggaagacgaaggtgaggaggaagccgtcgacgacgacggagtACCCGACCTTGTGCAGGGA
GTTGAAGCCACAACTCTTGATAGCCAGGCCCATGGATCTGAtgaggaggacaaggacgacgacgaagaagcgcaggaTTCGTTTGCCGTGGAGAACGAGA
TCATCAAGCAGCGGGTGCAGCGCGACCGGCAAGCACGTCAAAACGCGGGCGGCAAGCGGCGATCGCGTAACTCGGCCAAGCTCAGCATTAAGGGCAAGCT
TTCTCACAAGAACGACTGGTAAACATGGAGAGGATGGTACAGAGGCAGAATTACTAGCCAGTGACTAGCAGCAACGCCTAGTAGTCACCCTTTGTAGACT
GCTGGTCTCTTTGTCCAGTGTTTATTTCTTAGCAATGCATTCTTTGCATGAAGCTCTTCATATTTGTATTATGGGGGTCAAATAAGAATTTGTTAGCGGC
GAGAGTCATCGCTGCGTTGTGAGTGGCGTTCGAACGGCTATTGAATAACACAGGATGCGCTTTGCGCAGCCGCGTCTCCCATATCCTTGAGCACTTTTAC
TACAGCCTTATGCTTGCCGTCCATTGCGTAGTCGAAGGGCAACTTGCCGTTAGCGTCTTTCTTGGAGGAATCCGCCTTGTTTTCCATCAGCACTCTAACT
ATTTCCACTTTGCCGCCCTCGGATGCGCCGTGGAGTGCCGTCATCCCCGTTGTCGTCTCTGCATTAATGTTTGCacccttctgcagcagcaccaacgtgG
CCTCTTTGTGGCCGCTGATAGACGCCCAATGCAGTGCCGTCCGGCCACTTTTGTCCGCCTACCAAACGTGAAAACAAATACATCTTTAGCACTTAAGTAC
TTCTGGCTGCAACGcacgcacacacacaacTCAAGTGAGCATACCCCGTCGATTTCTGCACCTTTGTCAAGCAGCAGTGTACACAACTCTGCGTGATTGC
CTCCTGCCGCGCGGTGGAGCGCCCGTCG