Description :
From Genome Similarity Track
Location :
Scaffold_70:4347- 5695
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014698Protein of unknown function

Sequence
1348 bases(100 bases per row)
GCGTCGGCGTCGTGTACAGTACCATCAGTGGCGTCATCTACTCGGTGCTCAACAACTACCTGCACATGTCTGCGACGCTGGTCGCGACTGCGACAGCTCT
CGTGCAGTTCCCGCGCAGTCTCCGTTTGTTCACGGGCATGCTGACGGACACGGTTCCGATCTTTGGCTATCGCCGCCGCCCGTATATGGTGCTCGGGTGG
GGGTTGTCGTTCGTCTCGTGCTTGCTCATGGCGATCCTGCCACTTGGTGACCCGTACTATGGCGACAAGGCGCTCGCGAGTTTGGATCCAAGTCAGTTGA
CACACGAGCAACTCGAGATGATCGACACGGACGCCCCGCAGCGCGGCGTGAAGCTCATTATCCTAATGATGATCGCGAACTTTGGCACCGTCGTCGCGTA
CAGCGGCTTCAACGGCGTCTTGATCGACGTCTCGCAACGGGAACCGGCCAACATCCGAGGCACTGCTATGGGTGATGGCATGGTCGTGTTCTATGTGTTC
TCTGTGTTCTCGTCGTTCTTCACGGGCTTGGGTCTTAACAGCGCGGACTACGGCGGCACATTCTCGTGGTCGATCGGGTTCAACGCGATCATGGGCATCT
GCGCCGGCATGTCGCTCATCACGCTGCCCTTCTCGTGGTTTTGCATCCAGGAGGACAAAGTAGAGTCCGGCCCATCCAAGTCGGTGTTCGTGTTTCTGTA
CGAGCTGCTCCAAGTGCGAATCATTTACCGCTACGTCGCGTTCCGCTTCTTCTACAATGTGCTCGCACTGTTCTCGGTGACTGCGTCGAGTGCGATTCAG
AGTCAATGGGCGAAAGTCGAGCCGGTCAACAACGGCATCGCGACGATGCTCGCGGCATTTGTGACGATGATTGGGACGTACGTTGTCAAGAAGTACGGGC
TCGCATGGAACTGGCGGTACATCATCATCTCCGCCCAGATCGCAGTCGTGTGCGTCGACGTCTTCCCGACGATGTTCACAATCTGGAACGTGTTCCGCAG
CCAGTGGTTCTGGCTTGGCGTGCCGCTGCTTGAGAAGCTGCCGTACGCTGCGACCGACTACGTTGGCGCGTTGTTTATGCTTGAAGTCGAGAGCGAGGGC
TTTGAAGCCTCGCTCTTTGGCTTGGCGGTGACTTCGCAGCGTGTCGGCACGCCGTTCGCGACGGTGCTCACGAAATCTGTCGACGGTTACTTGGACATCG
AGCGTAACTACATCCAGAAAGACGACCACCACGTGCGCTCGCAAGTCACGATCGCGTACGTGATCGCGTACGCAGTCAACCTGCTCGCCATCGTATTTGT
CGTGCTGCTACCGCGTCAAAAAGACGAGCTGCACAAGATGCAGCAAGA