Description :
From Genome Similarity Track
Location :
Scaffold_179:43469- 45486
Sequence
2017 bases(100 bases per row)
GTATGGCTTAAGCAATCCAACGTACAACACTAGGTGTGGGCGCATTTTGCGCGAAAGATTGGATATAGGAAAGGCCTTTCTTCGCTAAGACCGTAAACGG
TCCGATGAAGCGTGGGAGCAAGTTTGTCTTGAAGACAGACCTCGAAGACACTACATTTGTAGGTAGATTTTTAGCATTTAGTAAGACTTGGTATACAACT
TCATAAAAATCAATACATTTTCTTTGCTTAGCATCAGTTTGTTCTTTTTGTTTGTCTTGGCTATCCGCCATTGCACCACGTATATATCGTAAGACACTAA
CCGCGTCGCAAGAAACTCGCTCACTTGTTTCTGCATATAGTGGGAGGGCTGATATCAGCAAGCTTGTCACCGGACTCTCCCCCACTAAGCCCAGAACCAT
GTAGTGGTAACGTGAGCGAAAAGCGAGGATGCGTGAGGCTATTAATAAAGAAGGAATTAAAGCTGTTCGAGGCATGAACAGCGTTGCCAAACGCAAACTC
AATGACAGGGAGCATCGAGCTCCATGTCTTAGGCAACTCAGCACAAACACTGCTCATAACATCGCCGATGACGCGATTTACTCACTCCGTTTTACCATCG
GTCTGCGGATGATCCGCTGTGAACATGTCCAATCGCGTGCCAAGCACCTTGAGGATGAAAGTTTAAAACTTGCCTGTGAAGCGGGATTGCGCTCAGAGAT
AATTACCAGCGGAAACCCGTATTGACGAAACATACGATTGATAAGCAGCATAGCTGTACTTTTGCCATCGATGGAATTCGGCACAGCCGTTAAGTGAGCC
GTCTTGCTTAGACGGTCAACAAAGACCACATTTTAGTCACAGTATTTGGGAAGACCAAACACAAAATCCATACTGATGGGCTCCCAACACCCCGCGGGCA
CAGGTAAACTGGCTAGTGGCGCAGCTGAATGTGCCGAGGGTTCTACCCGCTAGCACGTTTTGCATGTACGCACGTATGTGCTCACCCATTTGTAGAGCTT
GGGCCACAGGTTGTGTTGACTCACAGAGCCCTATGTGTTTTCCCGGCCCAAATTCCCACTGAGAGCAGTATCATGGGCCTCAAAGCGGATTCGATACTTC
AAATCCTCATCTCGAAGTATGAAATGCGATCGGTATCTGCTACATCTAAGAGACATCACAAGAGACAGCACAAGAGTCCATTATCGATGGAATATCTATG
TAGGCTGGCCCGCAGACGTGCCGGTAAATTACTGGCCGAGTCTTTGTACTCCCTATCCCCAAAGCCATGAAATAACGCCACACATTGAGAATCCCGTGGG
GAATGCCACGCGTATTCCTCTATAGGAGACTCCAGAGTCGTGACATGAGCAAGCTCATAATGGGGAAGGCGAGAGAGGGCATCTGCCAACACATTTTGTT
TGTATGAATTATGCTCCACCACTACGTTATATTTCGCAAAGTAGGAAAGCCACCGGGTCATTCTCTGAGAGAGGTGAGACAACTGTGTCGCCGTGCGTAA
TGACGCATGATCCGTGTAAAGACGAATGGCCTGGAGACAAGCAGATGAACCCTAAATTTGACGAGTGCATAGTTATTGTAAGTAGCTCTTTGTCGTGAAC
TAGATAGTTCTTTTCAGCAGCTTTTAGCATACGAGATTCAAATGTGATAATTCTCTTGCGGCCTGCAGCATCTGTTTGTAACAGAACTCTGCCTATGGAA
AAGTCGGATGCATTGCAGACAACACTAAAAGAACACTCCAGATTTGGCAACGCCAAAATGGGAGAATGGAGGAGACTCTCCGTTACTGCCCGAAATGCGT
CATTATGGGTCTTGCCTCAGCGCCAATTTGTGTCCTTCTCAAGGAGGTCAATTAATGGCCGAGCCATATCAGCGTAATTTTCACTGTATTTGTGTAAGTA
ATTGGCAAGGCCAAGCCGCTTACGCAAGTCTTTTTGATTTTCAGGAATCGGCCAGTCTACTATAGCATTGGCCTTAGTGGGATTTGCTGTGAGGCCGCGC
TTACCAAAGAAACATCC