Description :
From Genome Similarity Track
Location :
contig_25:434599- 436916
Transcript NameFunction/comments
g4979.t1hypothetical protein

Sequence
2317 bases(100 bases per row)
GGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGT
CGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGT
CGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCA
TGGTGTCTAAACACCATGTCGACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAA
CAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGA
TTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACGCGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCACTTGTACTGGTGACTCCAATAG
AAGTCACGCGTGAGAAGCAATATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAGCTCATGATC
ATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTGTTTGG
CCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAATACTCCAACAATTGCTTCGCATCCGCATCATGCGCGTATGTGGCCTTCACGTCATCTAACAT
GGACGACGAGAGTGTAGTCGTCGGCCTCTTGCACCTTCGTGATCGTGTTGCATCAATGCGCATCCGATCGCGAAATCGGATGCATCACACACAACGTGGA
ATGGGCGATCTTGGTCGGTCACCGCCAAGATTGGCGCCTCAGTCAAGCCTGCTTGACTGCTTCAAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCA
GCTTCTTTCTTCAAGAGCTGCGACAGCGGGCAATTCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTT
CCTTTACGTTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATC
TCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTGTGCATCTCCACAT
CCGATTTTCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTT
GAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCCGTGAGAGGGATATCACTCTCA
CGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCATTTTGAGGTATCGGCG
TCTGCGCCGGTACCGTCGCATCGTTCAGCTTGTTATACGCATGAACGATGCGCCACCGCCCTGTGGCTTCTTGACACAGAACGTAGGCGCGCTGTCCGGG
GACTTCGATTCCCGCACTTGTCCTGCCTTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGC
AATACTTCGTTCCCGGCACGAGATCAATTCGTGCTGGACACCCTTGTCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTATTCACGC
AAGACCTTGTAAAAGGGTCTCGCCTTGAGCGAATCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCTCCCTCAGAGA
TGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGAAGATCTGCTCGATGCGTCCATCGTGCAGGTCGCGAGCGAAACG
CTTCCAGCTTGTGACTGGGAGCGACATCAACTCCAACGCTAACGTCGGAGGGTTCTCCAGTCTCATCTTCTTGTATTGGAGACCAATGCTCGTACGCGTC
AAGACACTCAATGTCTC