Description :
From Genome Similarity Track
Location :
Scaffold_117:43452- 44510
Transcript NameFunction/comments
g15501.t1hypothetical protein

Sequence
1058 bases(100 bases per row)
CCTACAACACTTCCATCACCGCTACGCTGAGATTATCATACGGTTGATATTTATTCGAGTCTTCCACCTTGACCAAGTCGGTGTGGCATGTTGTAAACTG
AGAGACGACGCCGAGTTTCACGGACTCGCGGCCCAAGGACGAGTACGTCAAGTCGAGCAACATCGCGTTCGGACTGATGTTGCTCCACATGGACGCGGGC
TACGACCATGTGGTCGACGATTGCGAGGAAGCGGGGGTTGCGTGGACGCGCCTGAAGACGCTGTACGATGGTTCGCAGAAGGCTGGTCACATCTACCTGA
AGCGCCAACTCTTCAGCATGGAGATGTCGGAAGGCGGGAATGTCTTGCATCATTGCAGTGGGGTCCTCAACATCAGCGCCAAGATCAGCAGCATCGGCGC
CAAGATGGAGGACGAGGACGTGGCGATCTGCCTATTGCGCAGTCTCCCCAAGAGCTACAAGAACGTCGTGCTGGACTTGGAGATGAGCAGCGCTGAACTG
CGATCGCAAGACGACGTGAAGGTGATCACGAATGAGCTGATCAAGCGGCAAGGCGAGAAGACGGCGTCGGTGAAAATGGAGGACGCGACCAAGGCGTTCA
ACACCGACGGAGAATCTCGCCAGTACACGTACTGCGGGAAATTGGGGCACACGGTTGACAAGTGCTAGACCAAGCAGAAGGATGAGAATCGGAGCCCAAG
ACGCAGTGGCAATGGCCGTGGACGCAGGGCCAACAATGCCCAGTGGAGGAACGACGACACCTACTACTACTACGACTTTATGACGTGGCTGTCGCTGCTG
GGAAGAGCTTCTTTTCATGTCGTCACCGGCTACTTTCTATTATCAGTTGGGTTTTTTCACGAGAGCAGTTATACTGTATTTCCTATGGCTAGTATTGATT
TCGTAGTTGTGCGAAATGGGTTTAGCGTTCAAATGAAAGTGCAGAGACAAAAGGGCAAGAAGTACACGTTTAAGAAATTGATAGAAATTTAACAGAAATT
AGTTGATAATATTATACTTTATCTGACATGTTCTCTATGAAATGCCTAGTCGGCGGAA