Description :
From Genome Similarity Track
Location :
Scaffold_656:4345- 7170
Transcript NameFunction/comments
Phypl_g10107hypothetical protein

Sequence
2825 bases(100 bases per row)
ATGAGAGCGCAGTGGGAAGCCGCGCAGGCGGGCCTCCGCATGTTCttggaggaggacgacgactaTGTACACTTCCTGGAGAGCGTCGAACAGGACCTGG
CGCGGAGGCTGCGCTTCGAGTGTCGATCGCGAGGCGGATCTCTCGTTGAGAGCGTCGCCTTCGACCGGCTCGTGGAGACTGCAacacagctccagcacct
gcatACGTTCTTCCAGGCGAAAATGAAGCCAATGGCGGAGACTCTGGCGCGTGAGGAGATCGGTTCCGTTAATGGAAAGTGCAGCAACTTTGTGGAGATT
CTGGCGGACATGCTGAGCGTCCTCCGCGTCCTGTACGGGCAGTTTTTCTGCAGAAGTGATGCCACTCAAGCAGCACTGGAAACAGAGTTAACGAAGCAAC
CCAAGGATTGGGCTggggaggtgctggagaagtacCTGGAAAAGCAGCAACTAACTGCGGAAAAGCTGGTTGCTCGTCCGCTGAAACGGTTTGATGAGCT
GGTGGAGTTCGTTGCAGCACTGAGCAAAATTCTTTCAGAGgatgcagcagatgaagtCGTCAGCAATGACAGCGATGCAGGGACTGAAGAAAAGCTCAAC
TATGCTCCTCAACTGATGCATATCGTCCAGGAAAACAAGCACTACATTCATCTCGCCAAGGCCGACGCGTGCGAGGAAAAAGAATTAATTGCGCTACAAA
CCTGCTTCCACGGGAACGGAGCTGAGGCTTTCCATGATTTGTCCAACAATAAGTTGCTTCTTCACGGAGAAGTATTTCTGTCATTGAGGGATCCAAGCGA
TTGCAGTGGAGTTGGTTCAAAAACTACATGTAATACCAGTACGGGATCGTTCGGCTTGCCCGAAAGGATTTACGCTCATTGCTTTCAGGACGGAACAGTA
GTTTGCAGCAAGCGGCAAGATTCTGAATCAGGGGCTTCGTTCACAAttcttcgtcgtctgcagctcaagcatGATGCGGCCTTTCTGGAATTCATTCCGG
TCAGTGTACCAATACTCGAGCCTTCAGAAGAAGCCTGTGCTTTGGCGCTGGTTTTGCAAGACACAACACTTGTTTTTGTCTGGAAGGACGCAACGGAGAG
TCAGCGATGGGCTGATGTCATCGGGGGATTTCTGGAAATAAATGGATCACGGACCGAAGTACTTCACCGAGGCCGTGCGATTGGCGACCTCCCTGTACCT
GCGGAGATCACAACACAGATTGTCAAAACGGACACATTGCCGACGGAGTTTGTATCGTTTTACGACGATCATCTCCCAGGTGTTTTCTGGATGACCCTTG
ATAAGGAATCGGACCCAAGCAAGTCTCATTGGGAATTGGTTGAAATTGTCTTCTACGCTAGATGGCTGCTAGTTTTCAAGCTTGACGGATGGGGCGGACA
CGCAGCTTTATGCCAGTTTGACACTCAAGCGCCTGAGGTGGAGATTGGCGAGCAGCCACGAGGAGATAAAGAGTGGAGTTTGGTTATTTCCAATGGATCT
GCAGGCAGTCTCACGCTCGTATCGAAGAAAAGAACGAGAATCGACTTCTGGTTCGATCAAGTGTGGAAGGCCGTCGAGAGTGCTCAGGTTGCAGCTAAGC
GAACAGAAAGGGAGAAGAGTGAGCGCCaagagatggaggaggaggaggctcaCGCGCGTGGTGATAGCAGGAAGCGGAATGAACTTGCTGGGAAGAAGCG
AAAGCTCAAGCTGGTATCTAACAACAACGGGGAAAGCACGGCAGACGAGAAACAAAGTCCCCCCTCACATTTAAGTCCAGTAGGTTCTAATGGCTCCAAG
CCAGATGACAAGACTGATGAAGAATGTGGCGAGCAGGATAGGAGTACTACAATGATCAGTGTGGAACAGGAACCTCCCGCAAAGAAGAAATCCCGGAGTT
CATCTGACAAGCAGGCCTCCACTTCGGCCGGCACCGAAGGGGGCGACACTGTCACTACCATCGTCTCGACAGCTGTGAAAACTCCTAAGAGGAGGTGGTT
GACCAGGAAGTCCGAGGACCCCAATGACATTGCCCTGGTGTCGACCCAACCAAGCCCAAGCATCCGAACCGACGAGTCTATGAGCGAGATCGATGCTACG
CAGCTTCCTGCCAACGAAGCAGCGGCTGAAGATCCGAAGACCCAAGAACTGCGGATTATCCTCACTGGTGTGGAACCTACTGCTGCGATCCGAAAGAAGA
TCGATTCGATTGCAGGTGCTGTCTACGAAGAAGATGTTGAAAAGGCAACGCACATTCTGGCCCCGAAGAACCAATTAAAGCGAACCGTGAAGCTTCTTTG
CGGGATCTCGAACTGCGCGCACGTCCTGGATGTGCGATGGCTCGACGAGTCGGCTCGCGTGGGCGTTCCTATCTACGAGCGAGTTCACTGCTTGAAGGAT
GCGAAGGCCGAAGCGAAGTGGCAGTTTGATCTGCGGAAAACCATGTACGACTTCACCCCCGAGCAGCGACAGAAGCTCTTCGCCGGGCACCAGGTGTTCA
TCACCAATCACAAGtccgtgctgccgccggtgAAGGATCTGGTGAAGATCGTCGAGTGCGCCGGCGGAACTGCCGTGACCAAGGGCAGCGCCGGCCCGAA
CGACGTTGTGATCACGAGCGAAGCGGCGCTGGGCACGGCTTCAGTGCGCAAGGCGCTGACGCAGGCGAACCCGCAGCGGATCTACTCCGCCGAGCTGATT
TTGAGCagcatcctgcagcagcacatcgaCTTTGACAAGAACCGTCTCGAGCAGTcgagtggcggcggcagtcGCCGGCGCAGGTAGACGTCGGGGAGGC
TAGCAAAAATCATAACATGCCAATG