Description :
From Genome Similarity Track
Location :
Scaffold_166:43448- 44803
Transcript NameFunction/comments
Albla_Nc14088930transmembrane protein putative

Sequence
1355 bases(100 bases per row)
CGACCATGTGCTCCAACTACTAAATGTTGACATGCGAAGACGAGTTGGCGCTGATACAGTCAATGATTTCGTTACTTGGTTGACTTCAGCCTGAACTGGC
ATTGTATTTGGACATGGATCGATATCTGAGGACTCTGTAGTGTGGGTAGTACTTGGTTGCTCAGATGTGGCTTGCGAGGCTTTTTGGTACTCAAATTCGA
GCGGCAAAGGTACGGGCAAAAGATTTTTCTGCTTGTAGTCAAACCATTGACTCATACGAGGTCGTAACCAGGAATACACTTCAGACGGATCGCTTTGGAT
TCGTTCCAAGTGTTCATCAGAAGTATTTTCTCTGCGAGCTTTCTCGATCTTCATAGCCTGCCTTGAAGTAAGATGATGGATGAGCCCAGCCCCTTTCCGG
ATACCAAAATTCAGCAAACTTTTCGGGATGGCACATTTTATATCCATGTTGACCACAATGCACGCCTGAGCCTTGGAAGGCTCAATGGGTACAATTTTGG
CTCGGAATCCACGTATGTCAATGCGATCCACATTCCAACCTTTCATTTTTGGAACTTGTATCATGTCGTCCGGTGCCGATTGCCCAAGTAATAATATACA
ACGATGCTCGTAACAAGCATTTACTCCAAAGGCGTGCAAAACCGCATCGCGAGTCAAGAATGGCAATGAGACACTAAAGTAAGCCAATAGCTCTACTCGC
CCCACTTCTTTAAGCACCTCAGAAATCGTGCAAAATGGCGCCCAAAGCCTGTACAAATCGATTTCGCGAATAACAGCGAGTGTGTTGAGAACATCTGCAC
CTTCGATTAATCCATCCATCTTGAGCCAAATTGTGCCACTGTCACCTGGCTTCCAGTAAGTCGATACTCCGAGGTACGACTGAGCAAATTGCCATTCAGC
TTCTTTTTCGTAATTGAATTCATACAAAGCCTCCTGTGCAACAGCATTGCGTTTTTTGATGCGTGTGAGAGCAATTTTGTCTTCTTCCATCTCAGTTTGT
ACACTTCTACAGGAATGCAAGGAGGCTTGCCTCTTGTCCATTTGGCTGATATATTTCTCCAACTTTTCAAGCAGCATATTCACAGAAATGAGCCGTTCCT
CCACCCGCAACGCTTGTATATGCCTCCAAGCCCATTCAACGTTATCTTCAGAGACTACAATGCCTGAATAATCCAAGAGACATTCCATGTCGGATAAGTG
CGATTCCCCCTTCACCTGGTCGTCGAGATCTTCATCAGAGCTGTGCTGGATCGGTTCTTCATGCTCCAAATCGCCGGATTTCCTTGATAATAATGAACAG
GAGCTCGACGAGCTATATCTTGGCATAGCTTGAGAAATCGATGAGGACAAACTAG