Description :
From Genome Similarity Track
Location :
contig_45:434434- 436116
Transcript NameFunction/comments
g8140.t1hypothetical protein PHYSODRAFT_467340

Sequence
1682 bases(100 bases per row)
CGTGGCTGCGTTGTACAGCGCCCATGATCGGGAGAGCCCGTCGTCCATGGTCGCGTTCTTGAGCTTGTGCAGCGAGTCCACCGGGTCGACGGTCGCCGCG
TTCACAAGCAGCAGCGACAGCCACGTGTTGTTGCTGTTCTTCATGGTCACGATCTTTTCCTTGGACAATATGTCGTTCCACTCCTGCTCCACGAACGTCG
AGGTGCGGGCCAACTCGTTGATCGGAGACACTGGGATCATCTGAATGCCGTGAATCGCGTACTTCTCGTCCAGGAACCACGTGTTGTAGTAGACCTTGTT
GTCGAAGAAGATGCCCGTGACATGGTTGCGCACGATCGCTGGCGGGTGAATGGTGTTGTCCGACTGTAACAGGAAGTACGTTCGGATGGCGTGCGCGTTC
AGGCGCAGCATGAGGCTGCCGAGGTCTTCCACTGCCTTGTGGCCGGTCACTTTGCCCCATAGCGTCATACCGTAGTAGAAGTTGACGTCTTCGGACGTGC
TCTCTTCGTCCTTGCCATGGTCTAGTAGCGTCACACCACGCGAATATGAGTGGCCGTGGTACCAGGAAAAATGGCGGAATCTTGGAAAGTAATGATCTTC
AAGACTCGGGTTCGCGACATCACGCAGCATCGTCCAAATGATAGTTTCCAACTCCGGCATACGAGACCAGTTCGGGTCCAGGTGCTTGAGAATGGCCGAC
GCCGTCACGAAGTAGCCGAAGTGGTAGTGGTGGTCGTTGTAGATGCCGCTGCCGAAGTCCATGTACAGCCAACCAGTTTTGAAAATTAAACTGGAGACGA
CTCCACGGTAGAGCGTCTCGTATACAAGGGGTGGGGACAGTGTGTTGTTCAGCATTGGTTCAATCAACGTCTCCAGCTTCTCCAGGCAGTACGACAGCAA
CGTTGTGTCTGGGCCCACCACCGAGCTGTCGGCTGCCATCAGACACAGCGACGCGTACTTCTGGAAGTACTTGCCATTGTAGTACCAGCTATCAGCGTCC
AATTTCCAGTCTGCGATGATATCCTTCTGCAGTGTCCTTAGCATATCTGTTTCAAGGACCACCCAAGGCGATGGTTTTTTCGCCGGATAGAAGTCCACCT
CGAAGTCTGCTTCCGGCTCCACAAACGTCCAAGTTGTCGAAATCTGGCCGATCATTTTTCCACGGGTAGTAGAGTGCATCACGAGCACCCTGACTGCCCG
CCGTCGTCGGAGACCCGCTCAGCGATTCCACCTGGTGTGGTAGCGCGAAGTGAAGCAGACCCACCGTGTCACAGGTGTTGCCTTCGGTGGCCCAGTGCAG
CGAGTACCCCGTGCGCGACTCCATCGACACACTACCTCCGAGCACCATACACGATGCAAACTCGTCGTACACGGTGTCGTCAGCATCATCAGGGAGCAAA
GCCACTCGGATGGTGCCAGAATACCCAGCGTCCGCGACCAGCGATGAACCCGACGCGTTCACCGAGAACACGACCGAGTCCTCCACACGGAACGAGATAC
TCTTGTCGCTCGCGTACAGCACCCACGTCTGGCTGTTGTTGAGGTGGATGACGAACTTGCCCGGCGCCGAGTCGTCCACGGCTGTGATATCGTGTTCGGT
GTCGATGCGCGGGGTGAGTCCGTCGTACTTGGCCGATACAAACGCCATGCCGCTCACAAGCGCAGAGTCCATGCAGCTTCCA