Description :
From Genome Similarity Track
Location :
Scaffold_110:43429- 46376
Transcript NameFunction/comments
Physo_142213reverse transcriptase

Sequence
2947 bases(100 bases per row)
CCTTGATTGAATTCGTAGAGCAGGGCACCACAGTTGAGCTTCGACACAGGCAGCCACTCGGTCTCATCATACCCCTTCCACTTCACAAGGTACTCGCGAA
TTCGTCTCGATGTCCGAGTCCGTTTAGTCCATCGCAAATCCAGGATTCGCTCGACTTCGTACTCATCGTTCGCAGCGTCGGGCTCCCAGCTGTCTTCAGG
CAACAGCGCCGCATCAAACTCATCATCCTCGTCCACGTCGATCTCCACAGTGGGCCGCTTTGGGAATAGTGCTCTGGGTTTCAAACGGCTCACGTGTACC
CAGGGGTTCACGCGATATCCTGTGTTCTCAACCCTGAGTTTCACGCGGAAGTTGTCATGGATTTCCTGAATTCTGAAGGGACCATGCCACATGTGAGCCA
GTTTGCGGCTCAGCCCGGGCTGCACTTTGGGTATATACAGCCACACAGGATCACCGGCTGCGAATCATGCCTTCAGTCGTTCGGACAGCTCTCTCCACTT
CCTGGTTTGTTCGGCAGAGCGCGCCGGTTGGCCTTCTTCTGGAGATCATCAGCGCAAGCTTGTGCATAACTGTAGTCACGCTGCAGCTTCCTGCGCCACT
CGTACGCAGTGCGCTCCTGGATAATCGAGGGCCTGGGTCCCAACATTGCAGACACAGTGCCGTGTGCGTCCCAGCCGTGCATCAGAAAAAACGGAGTGTC
CAGGCGAGTGGCATCGAACGATGTATTCAGGGCAAACATCAAGCGCTCAGCATGGTCGTTCCAGTCGCTCTGGTCCGCCTCAGCGATGTACGCTCGAATG
CTGCGCACGACAGTCTGCACCGACCGCTCCTGTTGTCCGTTCGCCTGGGGGCGATACGCCAGAGTGGCCCGCTGCTTGCTACCCAGAAATTCACGGAAGC
GCGTGAACACCTCGCTCATGAACCTTGGGTCTTGGTCGTGCCTCAGCATCGAGCTCGCGACGAATCTCCTGAAGACTTGCTCTTCGTACACTTCGGCGAC
ATCTTGAGCTGTGGTGGAACTCATGGGTTTACACATGACGAATCCTGAGAACGCATCCTGAAAATGCAACAAGAACGTGTTCCCACGATCCGACTTAGGC
AAATGCGTCACGAAATCCATGGGCACAACTTCAAAAGGACGCCTCGGTTCGATGTTCCCAGGGGAAGGCCCTGGGTTCTGAGGGCGCCCCTTGCCGCTTG
CGCAATCCACACACTCTTTGACGAAGACTTCAACGTCAGCGTACATGCCGTGCCAATAGAACTCAGAGCGTAGTTTCTCGTACGTCCTCGTGATCCCCTG
GTGCCCACCCTGAAAATCTTCGTAAGCGTAATGCAGGATATCCGGTCGCAGAGCTTTCGGCACCACGAGTCTGAGTTCGTCAACCATGTCTCGGGGTCGA
TCTCTGGTAGACCGACTCAAGCGGTACAGGACTTCTCTGGAATCCAACACGAAATCATCAGCGACCTTCGCGAGTTTCCTGGCTTAAGCGTGCGACAGCT
TCGTCGTGTCGCCCTTCAGGAAATCCTTGAGTTGCAGCAGGTGATCATCTTTGTCCTGGTGCACTTTGATGCGTCGCCAGCGTTCTGCCTGGTATTCCAG
AGGCCCCATGGGTTCGCTTTGAGCTTCGATCTCCTGAGTCTGCGCCCGAGTCATTACTGCAAACACTGGCCGCCACAGGCAACGGAGCGCACTCAGGTCC
AGGGATATCCAGAGTTTCGACACCCTGAGAATCACTCCCCTGAATTCCAACGTTCAATAACACCTTCGGCTTTACCAACTTCTCGTGAATCCTGGACACT
AATTGCAGATGTGTTCGTTCATCAGCATCCTCCACCTTCCAGGATTTGCCAAGCGCGAGGGTTTTAGACGTCAGGTAGTCTGCCGCCTGGTTGAACTCTC
GCTTGACATGCACCAGCCGCACAGACTTGAACTTCGTCGTCAGCACTTCATACTCGGCCAGCTTCCTCTGGAGATTTGGCTGATTGCAGTTGATGAGACC
CTGGGCTTGCTGGATGGCAATCCTGGAGTCCCCAACCACAACGATATCCTGAATTCCACGCTCAATCGCCAGAGTGAGGCCCTTCAGAAGTCCATGATAC
TCAGCGTCATTCACAGTTACGTCCTCCAGGATGAATCCCTGGGCATCCAGGATTTCCCACCCGGGGACATGCCACATAATGCAGCCGCAGCTTCCTTGTC
ACGTGGAAGTCTTAGCGGCGCCATCGAAACTCAGAATACACCCCTCGTAGTCCGCTTCCAGAATTTCCATACTGATAGGCACTGGAGGTTTGACGCACCC
CTTGGCTGGGATCAGGTTTTCAGCGATCTCATCCAAGTGTTCTCTGGGAGTAATACCCGCCCCCACAATTGCAGCCAAGCCGTCTTCATCGCGTTGAACT
CTGCGTATATCTAGGTTCCAGTGGGACAACTTCAGACCCCACTTCACCGTTCGACCGTCTGCCGACTGCGAAGTCAGCAACCACTTCAACACAGAGTACC
GCGTGTAGACAACGATCTTAGGGCTGCCTTCAACCAGAGTGCGAAACACCTCCAGGACTCTCAGGATAGCAATCACCTCCTTCTCTGCAATGTGATACCG
CAGCTCAGCGTCATTCAGGACGCGACCTGTGAATCGAACCGGATGCACAATCCCGTCGTACTCCTGGCCCAACACAGCGGATGCTGCCCACGGGTTAGCG
TGGGGAATAATCACGAAGGACCTTGAACGATCAGGATGTCTGAGTAACGGAGTCGAAACAATCTTGCGCTTCAGGATTTCAAAGGCTTCCTGGGCTCTCG
ACAGGTCTCTCCTGAGTTTCACCTGTTCCTCAGTCAGCTCGTACAAGACGGCCGCGATCACAGGTAGATCTTCAATAAACTTGTTGTAGTAATTCAGACT
CCCCATGAAACTCTGATCGCCTTTCAGTGTCGTCGGGAACGGCAAGT