Description :
From Genome Similarity Track
Location :
scaffold_55:43416- 44493
Transcript NameFunction/comments
Pl_110966stomatin-like protein

Sequence
1077 bases(100 bases per row)
GCGTCAGCTTCACAGCTCGCGCCCTGTTATGGTGCAGTCGTTAGATGACAGCGGCATGCCCCGCCTGCAGGACACACCCGTGAACATTGTACGAAGAATT
GGCAGAATTGGTCACTGGATCGTGAGAATTGAGTGTGTTATTGTGATTATTGGCTGCAGGGCGTGCTCATCGTACCACAGCAGCGTGCGTGGGTTGTGGA
GCGATTCGGCAAGTTCCATGACGTGTTGACGCCTGGTCTGCACTTCCTCATCCCAATGGTGGACCGCATCGCCTACGTGCACTCGCTCAAGGAGGAAGCT
ATCAAGATCCCGGGCCAGACAGCTATCACCAGAGACAATGTGACCATTAGCATTGATGGTGTGCTGTACGTGAAGATCATCGATCCGTACAATGCCAGTT
ACGGTGTGGAGGATCCGCTCTATGCTGTTACTCAGTTGGCGCAGACCACCATGCGCTCTGAGCTGGGTAAAATCACGCTGGACAAGACATTCGAGGAGCG
CGAGTCGCTCAACCTGAGTATTGTGGAGGCCATCAATCAGGCATCGGAAGCTTGGGGTATCAAGTGCTTGAGATACGAAATCCGTGATATCTCCCCACCC
CGCAGTGTCAAGGCTGCAATGGACATGCAAGCTGAAGCAGAGCGTCGAAAACGCGCTGAAATCCTTGACTCGGAAGGTGAACGTCAGGCGTACATTAATG
TGGCTGAGGGTAAGAAGCGTGCTGCAGTGCTTGAAGCGGAAGGTGCTTCCGCTGCCATTATGGCCAAGGCTAACGCCTCGGCTGAGGCTATCGAGCGACT
TTCGCGTGCCATTAAAGAGACAGGTGGTCGTGATGCTGTGGCACTACAGGTGGCGGAGAAGTACGTGGACGCCTTTGGCAACATCGCCAAGGAAGGCACG
ACCGTGTTGCTACCTTCGAATGTCAATGACCCTTCCAGCATGGTGGCTTCCGCCCTCTCCATCTTCGGAAATATCCAGAAGCAAAACAGCAAGGAGGCAG
CTCGTATTGCTGGCAAGACGAGCAGTGAGGATAGTGCTGAGGGAAAGCTTAGCGAGTACACTTTGGACAGCTTCGAC