Description :
From Genome Similarity Track
Location :
Scaffold_503:43405- 47590
Sequence
4185 bases(100 bases per row)
TGTAACGGGGTTACATGGTGTGGAACACACAGGGGTACGAAGTACCCGGCGAGTTAACAAACTCTCAGTACATAAGTTGGAGAGTTAACAAGGTCTCTCA
GTACGTTGGCTGAAAGCCACACGTTATGCATTTGATTAGGTTTAACTATGCTAGATAGTTAAAGAGATACATTTACCCCTAGGCGGCTTGGCCGCAATAA
TAGTAAATAAATCACTTCTGGTTTTGAAGCATAAAAGTTAAGGTGTTAACTTTGAGCCCTGGTCTTGGGCTGTAAGTGTCCTTTGGATAAGGAACTTAGT
ATTAGTGACTCTTTGAGTCGAACGTCTTCCTCTGACGCTAAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCCGCTCCTGAGTCGG
TTGACTATATCCTCTGCGAGGATGGAACACCCCGTGTTCGCGAATTTGCCCCCGGCGCAGCAGGACGCGCTTAATAAGCTTATGTCCTTGCTTGGCCCGG
AGGGCGTGGCTCATCTTGCATCGCAAGGTCCAGAGGCGGTCACTGCCAGGCTGGAATCGTTCTCCCGCTACGAGAACGCGCTCTTGGAGCATGTCCAAGA
GAAGATTAACGCCGCAACGGCGGCGGCGTCGATGACGCGTGAAGAGTCTATGAGACTGAAACCGCTCATGGTGAGCGTAAAAACCTTCGAGGGGAAGGAT
GGAGAGAATCTCCTTCTCTGGACCCGTGAGGTCGAGATGGCCATGGGATCGGCCCTGCTCCAGTCTGAGCATCAGCGCGTGGCGCTGGCTGTCTCCAGGC
TTGGAGGTCGCGCTCGCGAATGGGCACTAACGTGCGGCACGTCTGTTGACGCTGCATTTCCCACTTGGGATCAGCTGAAGCAACAGCTTCGCGCGTGTTC
GCGCCGCCTAATCAGGCGTACCGTGTCCGGTCGAAGTTCCTTGCTACCCGCCAGGGTAAGAAAGAGTTATTGGACTATGTCCAAGAGTTGAGAACTCTTA
TCGCCGGAATGGCGGCGGACCCTCTTCCGGAACTGGTCAGTGTGACCGTGTTCATGAGGGACTTCGTGTGAGCGCAGCTCGAACGAAAGTGTTCCGTGTA
CAACCTAACTCTTTCGAAGAGGCGGTGAATGTGGCATTAAATGCCGAGCACAACTTAAGGTCGGCTCGACCTGGTTGGAGCGCTAGTAGCGCAAGCTCTT
CGAGCGGTCCAGAGCCGATGGACCTCAGCTATGCAGAAGATGAAGAAGCGGAGCTTCTTGCTGCGGAGCAGCGTGCCGGCATCCGCCGATGCTTTGTGTG
CAATAGCACTAAGCACTTGAGGGCATATTGCCCTCTGCGCAAGAAGCGCGTGGCTCCGGCGAGCCAACCCTCCGGGTCATCGCCGAGAAACGGCATTTCC
CAGTAGGCGCGGGGCGGCCTACTGGGGAAAATCTGAGTTCTGTTGTACCTCGAGGAGGTAGAGGGCAACGGGGCTCAGCCCCGAAGAGAGTTGAGCTCTC
TTACGAAAAGAGTGTGTGCAAGCCGGGCTTGCTGGTCGTTCAAGCGAACGTGAAGGGCTTTGCAAAGCCATGGAGAGTCTTGATTGACTGGGGAGCCTCG
GGCAACTACACCCGTCGCTCCACCCTAGAAGGGAGTCAGCTGTATGCTGAGGCACTGGAAGTGCCAACGAGAGATACGATCTCTGTCCGTCTCGCGACGG
GGACACTGGTAACTGTGTCGAAGGTCTCTGTCGACCTTGGAGTGAAGTTTGAGAACTTCGATAGCGTGGAACGCTGTTTGGTCTAGACCTGGATGCAAGG
TATGACCTCATCCTTGGCATGGCATGGCTGGAACGTCATGAGCCATGGATCGACTGGAAGTCGAAAACGCTGGGTGCGTCGCACCCTTCTCCTAGTGGAG
CTTTGGTGAGTCATGAACTCATTTCTGCTAGGAAGCAGAAGCGCTTTTGGCGCGAGCACGGGGCCGAGGCGGCCGTAGTACTGGACATAGGTATGTCCGA
AATTGTTAGCAACGAGGTTGCTGTTTGCCCTGAGGGCGTACGTGGTGCGGCACGTTATCCGCTGAGCGGTGCAGGTCAGGTCAATGACCAACTGCTGGGT
ACTGGTGAGGAAGAGCGCGGAGTGGCGCGTAATCCACTGAGTGGTACAAATCTGGTCGATGACCTACCGCTGCGTGACCCGAGGGCCGCGGTCGACTGCG
AGTCGAGGCATCATGGGCGTGGCCCAGAAGATGCAGGTGAAGTGACACCTAGTTCACTGTGTGAAGGTCAAGGACCTCTTGGCTTTCAGCCGAGTGTCTT
GCGAGACACTGTATCCGCTTCGAGGAGTGATGGTGCTGCTGCACCCGGCGGTGGTGACGGAGATGTCGCCACACCGCCCTCTTCCGGCCGGGCTCGGTCG
CGGAGGAAAAGAAGAAGAAGACGCAGGGCGTCTGTGACGTCTTCGACGTCGGACGATGTGTCCACAAGACGAGCCGAGCGGTGATGCTCCACGTGATTGC
TGTGAACAGCTGTATACACTCGTGAACGGACTCACGGGGGAGGTAGAAGGCGATAGCAGCCTTGGTACTCTGCCCGCTACAGATGCTCTGCTAGAGCTGG
ACGAGATGTCCATTGCCGAGTTTGGCGAAGCCTTAAAGGCAGGCGAGCTGGTCTTGCTGGGACCTGAGGAGGAGTTGAACTCCTCATCCGTCGTGAACGC
CGCGGTCCTAGAGGACACCAAGACGGCGCTGAGCGCAAGAAGTGGATCGGCGATCCTCAAAGATCCTTCGGATCCCTTTTACCCGGTGGTGAAGGAGTAT
GGAGACGTTGTCTCAAAAGACCCACCGACGGGCCTGCCTCCGGATCGAGGCGTGTGTCATGAGATTGACCTGGTTCCTGGAACCAAATACTGCGTAACAA
GGCAATGGCCTTTGCCGAGAGAGCAGTGTGACGTCATTGACGCATTCTTCCGTGCGAAGCACGAGGCAGGGATGGTGCGTGAGAGTAAGTCTCCGCACTC
GACACCCACGTTCTGTGTCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCCGATT
CCTCGCAAGGATGTTCTGCAGAACAACATGGTAGGCTGTACGCTGTACAGCGCGCTCGACTTGGTCGATGGCTACTACCAATTGCTCATGAGAGCGAGCG
ACATTCCGCTGACAGCGGTGAGTACTCCGAGCGGTATGCTCTGGGAGTGGCTGGTGATGCCCCAGGGGCTGTCGAACGCACCAGCAACGTTCAATCGTCT
TGTGACGCAGTTGTTTAGGCCCCACCGGGCGTACGCTCAAACGTACTTTGACGATATATTCGTCCATAGTCGTGCCGAGCACGGAAAGTCAGACGTGGAT
AACCACATTGACCACTTGCGAGCGGTGCTCGAGTGCATGAGCACTAATAAGTTGTATGCCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAAATACCTT
TCCTCGGGTGCTTCATTGGGAAGCGAGGCTTAAGGGCAGATCCTGCCAAAGTCAAGGCCATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAGACTTACG
CAAGTGGCTAGGCTTAGCCAATTACTTGCACAAGTACAGTGCGAACTACGCGGAGATGGCTCGGCCATTATCAGATCTCCTTAAGAAGGACGCACCATGG
TGCTGGAACGTCGAGCACGACGGAGCCTTTGAAGCTGTGAAGGAGAGCCTCCTCCAGGCTCCGATCCTTGCGCTACCGGACCCGGATAGTCCGTTTAGCG
TCGTCTGTGACGCCTCCGATTTTGCAATCGGTTTGCTTTACTACAAGCAGACGCCGTAGGGCGTGAACGCGTGATCGCGTTTGAGTCTCGCCAGCTCAAA
GCTGCAGAGAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACACCTGCTAGGCTCTAAGCCTTTTG
TGATCTTTACTGATCATGCGTCGTTACGCACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATGGCAAGATGGCTTTCCTTCTTTGCCGAGTATAACTT
CGAGGTGAAGTACAAGCCGGGGCGGCTTAATGTAGTGGCCGATACGCTCTCGCGCAGGCCGGACTACGAGTTAGCTCATGTCACG