Description :
From Genome Similarity Track
Location :
Scaffold_1051:434- 6610
Sequence
6176 bases(100 bases per row)
GGTGTGCTCGACGCAGAGGATATCTTCGAGCTAGCCCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGGCCATCACCGGAGAAA
GGTCGCGCACTATGGATCCGGTGTCGTTGCCGAGGGTCAGCCAAGCTGCGTCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGA
ACCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGATCCGAGGACAGGAAGCCCCTGTGAGCGTGAAGGCTCGGGAT
CCAGTAGGCCCTACGCGTGATCGGACACAATCCAGCCAGGATCGAGCCAGATCCGGCATGGAGCCAGTGGGACTATCGTCAGATCGGGCTCAAGGTAATC
GCCTCACGGATCCGGTCTCGCCAGTGGGCCAGACGGCCACAGGCTATTCCGACACACCCTGCAGCAAAACTTCGAAGCTGCGATGAGTCGTTTCCTGGCC
GAACAGGGTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTTCACGAACATGGAGCACGAGACGTGGAGATGGAGTCCGTGGAGGGAGACAACTCCCATA
ATGAGTTCGACCCAGATGATCTGGATGGCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGT
ACGGATCTCAGCCATATCGGATCTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGTCCCTCATG
AGAGATCAAGCGTCGGATGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAGGA
ACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGATGGCACGAAAATACTACCACGCTCGCCGCAGATCGGATGA
ATCCCCGCTAGAATACCTACATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACACGTGGAT
CATTTCATCGAGACGGTGGGAGACGTGAATCTGGCCGACAGGCTGACCCTGTTACGACTTCCCGACGCAGACGAGCTTGAGGAAGTGCTGCGGGCGGTGG
ATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGACGCCTACGGCCCCAGCTCGACGTGTCGACCAAGT
CACGGCGCCCGACTCAGGAACTGAATCAGGATCCGACGGTTCGGACTCCGACCCTGAAGATTACCGTCGGGTCTGTCTCACTGCGTCCAACGACCGAACG
GCGAAGACAGGAGTCAACTCTCGACCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGTCTTCATGGACGGGGCAGCACAAGTCAGGT
GATCACAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTT
CTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAAAAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCAC
CGAGGGATGTTGCCAGAAGTGGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGCTCTAGGTACTGCATTTATGC
ATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGATCTCTAGTTTGCGCCAAGT
GGATGAGTTTGCCAGATCCGAAGTCTCTTCAACCCTGGATCTACAAAGAGGAGAGGCACGTGGTTATTGGGAGAAGCGCCAACATGGCCGATGGTTTGAG
CCTACCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCAGGTCACTGAATCCCGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACCGGGG
AGTCCCGTGGATACTGGAAGTACCATGCCCAGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGAT
AGTGGTGCCGAGGTGTCTATACTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGACTGTGTTGGGGATTGGTGAA
GGCGTGAACCGTACGAATGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATCTGGGTTGGAGATCTCGCTGGCCAAG
ATGCCATCCTCGGGATGGATTTCATGGTACCGGCCGGAGTGAGGTTGGATCTAGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAG
CGAACGGCGGCCGTTGTATGGAGCGAAGATGAGGATCATAAGGGCGGATAAGACGACCTGGATCGAGCCCGGAGAAACCTGGGAACTGCCAGATCGGTTA
AAGTGGGTGGAACATGAGAAACGGTGGGTCACTCGGGGCGAGAAATGGGTGCCTACCGTAATCCAGGGACCAGGTCGATCGCAATACCTCCAGGTCATGA
ACGTCAGCGACAAGAGACTATTACTGGACCACTATGAAGAGATCGGACGATGGTTGGCGAAGGATAGTATCCCTAAGCGACCTGGATATGTGTCAGTGGG
ATCCCGTCGTTACAGAGAATGGCAGAATCTGGCGTACGAGGCGACTACCGAGATCGAATCTCTCGGAGAGGAGGGGTCCCCGGCGGAGCCAACTGGCCCC
TTGGTGGATCGGCCTTCATACCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGTCGAGATCCAAGCAATGGAGGTTGGATCCAGGACGGGGGACG
ATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGAATAAAGGATTGCAGAGGGCTAAAGCCGAACAGCCGGATCCCGCTGATCCACAAGTGGATCC
AAGCTTTCCATTGGAGAAAGTGCCTGGATCCCTATCGAGAGTGGCAACACTAGTCAAACCAGAATCGTCGGGTTTAAGCTCGTTAGAGGACCGACTAGAT
CCGACCGGTGACTTTCCCAGTACCAGGATACCCGACCCCACGAAGACAGAAGGGATGACGGTCGAAGGAGAGTCGCGGTGCCTGGATCCAAGGGTGGATC
AGACAAAGACCGAAGATGAACAAGTCTGCTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGCGGTGACCCCGGAGGTACCACT
GACCACAGAAGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGACGAATGAAGCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGAGCCGA
CATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAGAGGGTGC
GGAAGGCGGCGCCTCAGTTCCGAGAAAAACTATCGGATCTAATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTTAACGTCCCCGTGGGCATCCCC
AGCGGTATTCATCATCAAGAAGAACGGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGTC
TCTAATCAATGAGCTGTTGGAAGATCTGGATAAAGTACTCTGGTACGGCTCTCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCT
CGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAGCGTCTAATCG
ATAACGCCCTCTATGGATTCACCGGAATACCGGAACCCAAAAGGGGTGGATCCGGGGAAAATCATACGGAAGTAGATCCATTTGAGGCAGGAGAGCCAGG
GGATCCTGGAACCCCGTCCGTGTTAGGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGTTGTGCGAAAGAGTGACATCC
CTACTGGAGGCGTGTACTATAGGGGAATCTCTCTATCAGTGTGGGAAAGAGCTATTGAGGAATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCTAAG
GAGGGATTGGAGACGAATCCTAAGGACCTGTCTTCGTTAGACGATTTGTCCTTCCCGCAGTCGTTACGGGCGATGCAATCCTTCTTGGGCAGTTTGAACT
ATTACAGTCGGTTCATCGAGGATTACGCCCTGTTTGCCGCGGTATTTTATGAATTGAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCGGAT
AAAAATCCAACAAGCTCTGGCCCGGGAGATGTCGGGTCCACGAAGGGATCCAAGTGGTACGACGCCAGAAGAGGACCTAAAACAGGAGCTGGATCCACCC
CGGGACCAACGGAGAGAGGATCCAGTCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGG
AACTGAGGAACAGGATCGCGACCACGCCTATCCTCCGTCATTTCGATCCAGAACGTCAACCTACGGTAATAGTTTATGCCAGCGACTGGGCAGTCTCAGC
AGCTCTGGTACAAGAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAG
ATACTCGCGCTCCTGCGCGTGTTGGATCTGAATTACAACCTGCTGGTGGGAAGATCCATCCGGATCCTGACTCGACACTCTACGCTAGCCTGGCTGTTCA
AGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTAGACGCTGGAGATTGTGAAATGCTCGAAAGGGGAAGACGAGATCCT
GGTAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATGGATGAGGCGCTGACTAGGGTCGCTCCTAAAAAAGAGCCCAAACGCCGGATCCAGATCCCG
ATCCCGACGGTACAGGCAGACGAGGATCTGTACGTCCTGAGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGCGGGGCGTACAGTGCGATACTGTGGA
GACTACCTGGATGGGAAGTACTACGGGCCAGATCCACTTATGCGGAAGCCTCACCGTCAACGAAGCGGAGTATAACGGGCTACTGCTGGGTTTGGATCTA
CTAAAGGGACAAGATCCGAAAAGGCTGGTGATTTGTGGGGGATTCAATTTGGGGGATCAGACAGGTGCGAGGTGAGATTGACTGCAAAGGCCCCGGCCCT
AACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGTTGGATGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCAAATAGTTTG
GCCAGCGCCGCTTTACGGAATCAATGTGGTGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTGAACCGACTAGACGAAGTGGTGGTAG
TGGGGTCCGGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAACCCCCAAATTCTCAAGGAAACATTTGTGAAGAG
AGTCCGCATCGAGCGGATCATCAAGCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAAG
ATGCCAAATCCTACAGCATTATCGCTACGGATTACGCGGTGGATCTGTATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAGGATCGGGA
TGGATTGATGAGACTGGTGATGCCGGAAACCTTACAACAGGATGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCGGACC
TACCAACGGATCCGGGAATGTTTTCACTGGAGGGGACTATTCAAGAGCGTACAAACGGTATGTCGGGGAATGTGTG