Description :
From Genome Similarity Track
Location :
Scaffold_1177:434- 2431
Transcript NameFunction/comments
Phyag_g9783putative endo-1,3-beta-glucanase

Sequence
1997 bases(100 bases per row)
GGCTCAAGCGCAAATCGGTCCGGAAGGATGTCGAACCGAGCTGGCTCACACCAACCTCCTCCGCAGCAGGAACTATGACCGTTTCTCCGTTTTCCCGGGC
TGTCAATGTTTTAATACGGTGACCACCGAATTCGACTGAGCTGAGCTGGTACACCCGTCAGCGACAGATTCAAGAAGGTGCAACGCTTTCCGTAGTGGTT
GACAGTGCGACACCATTCGCAGTTGCCTGCAAGGGCCAAAAGTGTACGCCCCCCCCCAGGGGATACTCAGTATCTAGCTACGCGCTCGCGTGCGATCCAT
GTCGACCGAGCCAAGAGGTTGCTGTCCTCGTTTCAGCCTGAATGAGCAAGTTGTTCGCAAATTTTGCAGTGGCGTGCTGCGCTACGTGCTCTGCGACCGA
CGCCGATTTCTACTGAAGCTATGTCAAATCTTCAGACTTGAAGCTGAACTTTCGACACGAcgaccgcttcaacttgcctcCGATTGGTCGAAATCCGCCA
AATTCAGGTCAAACCCCACGATTTAACACGTTGCACTTAGGGCGTCCAAGACAAGTGCACGATAACGTCTCATCGGGCAtcgaccagcagctcatggcTT
CGTATCAGCGCAGACATGCACCtccgtggctgctgcaattgctcTGTGATTGCCTGTCGGACAGTGCAATCTGACCAGCTCGACAAGTCGATCgactcac
tttccatttcGCCTCGATCCGCCCAGTACACCTCCACAGTaccaccagcatcgactCCAGTATCTCTGCAGTCGCCTCCATGTTGTCATCGAGTCCCAGA
CCCCATAGCACCGGCGAGATCCATCCCCTGCTAAATACCAACTCTACTCCGCTCACACAAGCTCCCGTCCGAAGCCGCGTGAGTCGATGGAGCGTTCTTG
CAATCGTATCAACTCTCCTGTTCACCGCCGCAGTGTTCGGCGTCTTTAAGCCGAGTCCTTCGACCTTAAGAAGTGTAACAACCGTGTCACCCGATGCCAA
GTTCGACCTGTTCACACCCATCTTCAACGCCGAAGCCCCGCCCCACAGTCTCTTCAACCACACCGACGCacacaagacgctgctgccgcccaAGTTCCTG
GCCCCTGGTCTTGTAGGCTCCCGTCCCATTCCGACCAATGACTGGTGGAGCAACATGATCGGCGCCACGGTCGGTGAGGACGAGGTCGTGTACCCCGTGT
GGACCAACCCGTACAGCGTGACGCCTTCCATCTTCTTGGAGCCCTACGGCCTCACGATGAACTACCCGTATACCACCCGGTTGTTCGGGGGCGGCTTGAC
CGGCAATGGAGACGCCGAGATGTACTATCTGCACGGCCAAGTGCCCGAGTTCGCCTTCTCCGCGACTGAATTCTCCAACGCCTCGCACCCCCTCTTCGAG
GTCTTCGACTGGGATGACCTCAGTGTGCAGCTCCGCTTCATGTCCCGCGAAGACTcggccaagaagttcgaggtgACACTCGTTAGCGGAATGGCGTTCG
TCGCGGCTCGTTATTCGGGTCTCACCCCTCGCTTCCAGACCGTGTACAATATCTCGACCATCAACGGCATGAACCCCGCAGAGACCGTCAACCGTCCGCT
CACCAACGACCGATACGTACTGCAGTTCGACAACGGTGCCACTTGGACGCTGTACTTCTCGACTCAAGTCACACTTCACTTCGACGGTTACTCGACACTT
GCTATGGAGCAGCCTTTCCACGGCATCGCCCGTGTTGCACTCATCCCCGACGCATCTGCACAAGAGCAAAGGATCTTCGACCAAACGGCGAGCTGCGTTC
TCGATGGTGGCCGCGTTGAAGCCCACAACGAAGACGCGTACGCTTACAAGTGGCAGACCAGCGGCGACTGTACCAACGGAATGTTGCACTATGCGCAGGT
GCACCACATCGACACTCTCGACCGTAGATACGCTGTGGAAGCTGAAGGTGTCGCTGCGCATTCCACCACACGTGGCCTGATGCAAGGAGTTGTGACT