Description :
From Genome Similarity Track
Location :
Scaffold_1798:434- 1945
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1798-fgenesh-gene-0.1Major Facilitator Superfamily (MFS)

Sequence
1511 bases(100 bases per row)
TGCTGTATTTACTTCTCGACCACGTGCTTTGTCAGCGGCAACAGGAACGTCTCGAGACCCAGCCCCACGACGTAGACGGCTGATGTGATGAGGAAGCACG
TGCGGTAGCCATACGCGTCGATGATATAGCCGCCGAGCACGGCGCTGCCGGACCACGAGAACACCGATAGGCCCTCGAGCGCATTCCAGCGCGCGCGGAC
GTCCTTAGGCACGTAGTCCATGAGGATCGACCGGCGCAGCGGCTGTGAGCAGCGCATCATGCCGCCGCGCATGAGGAAGAGCAGGATCTGAAGCACCAGC
GGCTGCGCGTACGCCATGAAGAACAGGCAGATCACCGAGAAGCAGCGCGTGAACACGATGAGCGGCATGCGGCCGAACTGCTTGGACAGGCGCTGCGTCA
AGAACGAGAGTGCCATGACGAGCACGGGTTGACTGATGAAGAGCAGACTGATGTGGATCGGCGTGAGCCCATACTCCTGGATGAAGAAGAGCGGAAAGAA
GTTGATCGTCATGCCCGCGCCGTTGCTAATGATGAAGTCCGAGAAGAAGAGGATGAGCGGCACGTGGCGCGTGCGGAAGCAGAGGAAGCGCACGTCCTGG
CGCGCGAGGTAGCCTTCCTCCAGCTCTGGGTGGGCATCAGCCTCTGGAGCGAGAAGCGCCGACGCCTCGGTGGCGATGATATTCGTGTTCTTCTCCTCGT
CGTCAGAGTAGTCGAACTCAATATCGAGGTCGTTGCCCGCGACCGAGGGCGTGCGCAGCGGCTGTTCGATCTCCTTCTCCTTGTGGTGCGCCTTCGCCTG
GATGTTCTCGTACGCGAGGTCATCGTTGAAGCGGAAGAGCAGCAGCGACGACACGATTGTCAGCAGTGTGCCGAACTCGAGCACAGGCTTGAGCTCCTTG
AGGTGCCACGCGTCGCCGTAATACAGGAACAGCAGGATGCTCACACCCGGACCGAGGATCATCGCCAAGTTGCTCACGTTGTACTTGATCATGAACGGGT
ACGAGCGCTCGCCGTGCGGGATCGAGTCGGCGAAGAGCGCCTCCATTGCGGGACTCTGGAATGCCGCGAACAGTCCCCAGAGCGCAAACGTGACGTACAG
CAGATTCATGTAGCTGCCGGTGACGGCCCAGAGCGTCAGCAGGGAGCTCAGCAGCCCGATGATGCCCGAAATCTTGAGGATCGTGTCGCGGCGGATGCGG
TCCGCAAAGTAGCCCGCCGGGAACGAGAAGACGAGCTGCGAGATGCCCTGGATGCCCTTGACCACGCCAACGGGCTTGGTCGAGTTTGTGAGCACGAACA
CATACCCTGAGAGCACCTGCTGGAACAAAATGCTATGGACGGCATCGTAGCAAACACGCGCAGGTGTCAGTCAACGCATACACACAGAACAATGTAATCG
AGATACGGCCAGCGTGTTCATGCAGCGTACGCGCATAATGCGCTCGTGACTCACCTCCGTCCGGCCCAGTAGAAGAGCGTGAAGACATACGCGGTTTGCA
CGTTGTGCGCG