Description :
From Genome Similarity Track
Location :
Scaffold_1754:434- 1888
Transcript NameFunction/comments
Hyaar_Emoy2814808myosin-like protein

Sequence
1454 bases(100 bases per row)
GGAACTCGACAAGTGGCAAACGATTCGGAAAGGCAGCACGACTGATGCGAATGGCAGCGATCACGCCAGCACAGCGCAGTTGCTCCACAATCATGAGGCG
ATCAAACTCAGTTGCACTCTTGTTCGCGTTCGGCTTGATGCAGCGCACATACTGCGATGAGGTCTTGTTAATGGTCAGCATCAGTTCTGACAGTTGCTTA
CGGAACGCACCAGCGATAGTGTTACCCACTAGAAAACACTTTGGCGGCCTTCTTTTCCGTTCTTGCCGCGGCTGCTGCCGTTGCTTGCCTTTGTGGGCGT
GAAGATACCTGAAATGACTTCGTTGTGGCTACCAGACAACAGCTGCACCATATCCGTAGGCAGTGTGTCCTTGTTCTTCTCTAAAAAGCCCGCACCGTTG
TACGTCACATCTCCAGCACAATGGTGGATGATGAACTCCAACGGATTGATCCGGTTCTTTTCAATGCTCGGGTGGTCGCTGCAAGCATCTAGAACCTTAC
TCACAAGAGTACTGTCGGTAGCCTGAGGGCGGAGCACTTCCTCATTCAGCATGCTGACGATACCCATTCGACCCTCAATCAGGTCTAGGATCGGCTGATT
GTCGTCCTCAAAACGTCACCAGCGTTGACGTCAACGGAATGCCTTCATCCACGTACTCTTGCTGCACATCCTTAAACATGTCACTGTTGAACTTCTGCTG
CAGCTTCTCGTTGGCATAGTTGATGCACAGCTGCTCGAAGCTGTTCTGGTCAAGCTTTCGAAACCAAAGATATCCAACAGATCAGTGTGCGTCTTGACGT
TTTTCGAGGAGCGAATAGCCTTGTTGGTACGTGCACGAGCCAGTGCCAAAGCTTCATGGATATCCGACGCCTGTTTGGCGTTCAGCGGAATCGTGTACGA
CTCGGAACCAGCTGTAATGGATCGTTTCAGCAACGTCGAGTGGAGTGCTGCGCTTTTAGTACACAGCAGCGCACCGACATTGTCCACGATCTCTTCCTTG
CTCACGCGATTCTTTCCGCTGTCATTGCGTTCAGCGCAAACTCGACTTCGGCCAGGTTCAAAATCGTGCCACGATCTCAAATATTGCATTCTGCTCGTCC
GTGGAAATGCCAATCGTATCAAGAGCACCCTGTGTTTCTTTCAAACACTGGACATCATCAATGCCCGTCAATTGAGCTTTCGTTCCTTCAGCCACGTACT
TGCAGCTCGTGGCGTCAACATGTAGCCGGAGCTCTTTCTTCCGCTCGTCGGACAAGCGAAAGATCTGGTAAACACGTGGTGATTGCGTTCGCCTTCTGTC
TGACCCACGACACGACTCCTTTCCAGCAAATACGTCTCATCGAGACATCCGACAAGAGACCTATCGTGTCGAATTGCAGCTGCGCAAACTCGCCAAAGTG
ACTCGAGTTGTCATTCCTTTTGGTCTTGGCATTCCCAAACGACGATATCGGTGG