Description :
From Genome Similarity Track
Location :
Scaffold_923:4339- 6403
Sequence
2064 bases(100 bases per row)
AGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAACAAATCTGGCCACTTGTTCCTGGTGGGATCTGCCCAGCTGCC
GATACCAATTCCTGGCTGGTCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCTGACGCTCGATCTCGCATGAGGGCCGACTTGACTTTGCT
GATCCATGTTCTCGCTCGGTCATCGTCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCA
CCTTCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGG
ACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGC
TTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGAGACCGGATCCGTGAGGCGATTACCTTGAGCC
CGATCTGACGATAATCCCACTGGCTTCTTGTCGGATCTGGCTCGATCGTGGCTGGATTGTGTCAGATCACGCGTGGGGCCTACTGGATCCCGAGCCTTCG
CGCTCACGGGGACTTCCTGTCCTCGGCTCCTCGCCTCGGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTC
TGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTTACCCTCGGCGACGACACCGGATCCATAGTGCGCGACCTTTCTCCGGTGATG
GATTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTTGCTCGAAGATATCCTCTGCGTCGAACACTTTAGCTACGATGCCTG
ACTCCGTAAGCAAGCGTAATTGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTTACGGGCTCCCTTGGATCGTCGATCTGTCGTGG
ATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGAT
CCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTTTTTCTCGTTTCTTCGACTAGCGGGCTTGGGT
TTAGGTACGGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATC
CGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAA
CTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACTTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTGAGCATCTTC
ATGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCGGATCCAG
CTTACCAACTGCACCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTTCTCACCTTGTGTACCCGTCGGTAGGGCGGG
ATCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGCGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCAC
TCTGCGTCCGTGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTGCGGGTGTGTT
CCCTTGCCTTTGTAGTTCCTTTGCGTCGTACTTGCCGGCTCCTGTGACGGGATCTTGAGAGTTG