Description :
From Genome Similarity Track
Location :
Scaffold_5:43373- 45997
Transcript NameFunction/comments
Phypl_g226conserved hypothetical protein
Phypl_g227conserved hypothetical protein

Sequence
2624 bases(100 bases per row)
ATGGCGCGCGGAGCAGTCGGACGCCCGAAGAAGGATGGAGACCACACGCGCAAGCCCCGCAAGAAAAAAGACAAGAACGCCccgaagcgcgcgctgtcgg
CCTTCATGTTCTTCAGCAACGACATCCGCGACacggtgaagaaggagatgcccgagctgcagttcctcgAGATCTCAAGCGAGATCGGGCGccgctggaa
gaagatcacggacgacgagcgccgGGTAAGGCAGCGATTGTCCTCtgctgtgcgtgtgtgtggATACTCCTCGCTGACTGTGTTGCCTCTCTCTTTCCtt
tttgctgcagccgtacgacgagctggccgccgccgacaagCGGAGATaccaggaggagaaggaggactACGTGCCGGACCCGTCCTTCGAGACCACCAAG
GGCTCCCGCAAGAAAAAGGACCCGAACGCCcccaagcgcgcgctgtcggcttacttcttcttctgcaacgACATCCGCCAGGAGGTGCGCGACGAGAACC
ccaacaagaagatcacggagatcgccacgctgctggccgagagATGGCGTGCGCTGCccgacaagaagcgcgtcCGGTACCAGAAGATgcacgaggaggc
caaggtCAAGTACCAACAGGCGATGGACGTCTACAACTCGGTCGGcaccgtggaggaggagcacgaggaggaggagcacatcgacgacgatgacgaggag
gacgatgacTAAGTTGACGTGTTGGCCAGCCTTCTCTCTTTGCTTCGTACGCCAGGACGGAGGGGGGTGAAGCAAGTCGGCAAGCGGCGTGCGCTATGCG
CGCGTCGCTCTTTCTTTTAGCTCGGTAGTAGTGGTAGGACTCGCACGGTATCCTCTTTTTATTCTTTCAAGCTTTTGGTAACGTTCGTGCGTTTTCCCTT
TCAATGCGTGTACGTGTACATGTGCTTACGACGTCTCGGTAGTCGCGCTTCATCGTGTTGTGCCCTTGCGTCGGGCTTGTCGTGGACTTACCCGCCTGTA
TGCGCTGGAAACTTGGCCTGACAAATAACGGTGCATGCATAAAGGAAACTTGCATGTTTCCTTTTTTCTCCCGGTAGCTCTGGAATCATCTTCGTGTTCA
TGCTGCGGTGCGGTGCTGGTGAGTGCTGGCTTCAAGTTCAAGTGCACCAAACGGAACGGAACAGCGATACCGGTGTTACGAACGGACACGTCTCCCATGC
AGCGATGCCTCGATACCGGGCATGACCCAGCAATGTAAAGACCACTTTTTGCCGACAAAACTAATGAAAGCCACTACAAACATACAGATGCCAGTGTGCG
TCTTCTTTCTTCGCCCATATCCCCTATCTAAATGCAGATACCACCGGTAGTCTACAGTGCCtaatgcagcagcacgtcgaagtcGGGGGTCACCACGAGG
TGGCGCTCCACGTTGCCCAGGATGCTAAGGTGCTTCTCGGTCGTGTTGACGGCGTAGACCTCCTCGCAGAAGGATGGTGTCTGGGCTGCCGCCACCTCGA
ACTGTTTGTCGCCGAGCATCAGCACGATCTTGCCCGACTTGTGCACACAGATCTGTTGGCCGCACAGCACAAATACAACATTAGAGATGGGCCTGCCAGC
TAAACAATCGAggcatcgtcgccgcctcTTACCTTGCCAATGAAGCCACCCGGCGCCGACTCAATCGAGTGGTCAAACACGCCATCATCCCTGTCAAAAC
AAAACAGTTAGAAGCGCCTAATGACAGGCACAAGCCACGCTAGCACATACGGAGACTCTTCCGGGTTCTTGctctccttggccttcttgactTCCTCCTT
CGACTCGCCCGCAGTCTCCATGGATTCATCCTCATCCGCGCTGGCACTAGGCGCCTTCGCAACCGCACTCGaaagcggcagcgtcgtcggcATCTGAATA
AAGAACAGCGAGTCGTCAGGGGCCACCAGGTCGCCCGCGGCGTCGCAGAAGACGGCGCCCGCGCTCTCGGGCTCCGGCGGCCGCACGATCGGCAGACTCA
TGGGCTCCATGACCGACTTGACCACGGGTGGCCACACCTCTtccatctccatctcggGCACCTTTCCTCCAGGCAtttcctcgtcgtccagcacacTGAT
TCCTGTGCCGCCAGCAGCCGAGTAGTCGcccgacggcgtcgcgcgcGGAGCAGGcccgctgccgcctccgctGTACGGAGATCCGCCCGACAGAGTGCCC
ACGAACGCGACCTTGCCGCTGGGCAGCACGCCCCGGCCGCGACCCCGACCGCGTCCGCGGCCACGACCTCCTCTGCCTCCTCTGCCTCCGCGCCCTCTGT
TGTCGCTCTTGagtgctccagcgccggTTGAGTGCGGTTTGGCATCGATCGAGCGCtgcggagcagcagcggcagcttcgccatGCTCTTCAGAGACTGG
ACGGCGCTTGGCAGCCTTCGGCACGAACTTGGGCCGCCGCGCAGGGGCAGCGGACGCGTCGCCCGACGTGCGCAGGGACCTGAGGATAGAGAGGCGTAGC
AAGCGTTAGAAGGATGCTTAAAGCAAGCGAGAAGGTGCGACGGAGAGCGGGAAGagaggaggtggaggtcGCGCAGGTCGACGTACGTGAggcgcgcgct
ggacgcgtcgacGCGAGGACGCac