Description :
From Genome Similarity Track
Location :
Scaffold_101:43369- 45117
Transcript NameFunction/comments
Phyke_g4002hypothetical protein PHYSODRAFT_312945

Sequence
1748 bases(100 bases per row)
GTTCCTTACGCACGCGCTGGAGCCATGTGGATGCCTTTTGATAAGACCCATTCAAGGTATAGGCTTCCTCAAAGCAAGTGCTAGCCaactcgagctgctt
cttgctgtaATGGCACAGTCCCATGTTGTGGCTTGTGACATGGTGTCTGCCCATTTCCTGAGCGGATAGTGTGTAGAAGGCTAGAGCGCTGTCATATTCG
TGCAAGCCGTAGTAAAGGCGTCCAATCTCAAAGGCAACATCCTTCTCTTTATCCAACGCGTAGTAGTTTTTCCAGACAAGCGGTATCCCATACATCACGT
CCTGCTTCAgtttagcagcagcagtcggCGATTGGTCTAGGAGCACATCTCGGAATTTATAAAACACGTCCGGATCCCAGCCGCTGAGTTTCATCAGCGC
CAACACTGCCTTCAGTGATGGTGCCTTCGCATCTTCCTTCGTGGATTTTTGCATGACAAAAAAGTCGTTGGGCCCAAATGACGCGATCTCATCTTCAAAT
GCTGTTGATAAGTGCGGGTACTGATGACTGCGCTTTTCGCACACCCTGTCCAGTCCGTCACCGTACAATTCCAGCATAGTCGAGCTGGCAGCCAAACTTT
CGCTGGCAACATTCGCAGGGAGCACAAACGCAGACACCTTAAGACTCGCTTCTTCCTGAGGACTGTGAAGTGCAAAGCCACCGCGACTGGCAAAATATAC
GCCAATTGCGTGGTAGTTCACCATGACGGAGAAGCTGCCGTGAACCGCAATATGCGGGTCGGTAACGCCTCGGAAGTGGTCAGGATTATTATTCCCTTTG
TCACCAGATAAAACTACGAGCCCACGATTTGACAGCGCACTAAGGCGCTCGAGGGCCGTGAGGGCTCCAATTGGCACAAGTATCGTGGCACCAGAAGATG
CCGGGTCAAAGTACTCGTGATACCATTTCAAGATATTGTTGCAATGCGGCCGCGACTCGCCGTAGTATGtctcgtcgatctgctcATACTTGAAAATATT
GTTCAGGCGTTTGATGATCTCCGGATCCAGCGGATCTGGTTCTTCTACTCGTTTCGAGCCGACACTAACCAGACCTTCCTTCAGCACACCGTCATCCACT
TGGAACAGATCGTGGTATAGTGTGTCAAACAGGTAATTCGCGATGACACACAACGGGTTAGCCAGTTGCCCAGGTCGAATAGCCTCCCCAGACGAGAACA
GACGCAGCTCCGTGTCTGTGGTAGCGTCAAAGATGGCAAAATCCACAATGCCTCGCTTCACGAACGGTGCCAAGGCTGGATGAGTTTTCCAGAAGTTAAA
GTTTTGCTCTGTAAAGTCCGTCATGATATAACGGATGTTGGTCAGCGGGAAGTCCAGCACGCTCTGTAAGCAGCCCAGAAGACACATTAGCATCGTGCAA
ACACTTTCAAATGCTACTAGATCACTTCCCCTGACAAAATGAACGTACCTCCATCTGTGCTAAAGCTTTAAGAAAATAAAAACTGAATTTGCCCGATCCA
GCACCGAGTTCCACAATGTAAAAAGGCTTGGAAGGGTCCAGAGGCGAGGCTGAATCCGCTCTTAAAGCGTCTCGGAAGTACGCTCGTAGCGTGTTGCTGT
AACGCTTAGCAATGAACGTGTTGGACGTGATAAAGTGCGGGACGATGCCTTGCGCCCACGACTCGACGCCCTGGCGGTCGTAGAAAGACATCATGAGCTT
CCACAGGTGGCAGCGGGCGAACGGCGTAAAGTCTTCGAGTTGGCAGCG