Description :
From Genome Similarity Track
Location :
Scaffold_19:43362- 54552
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_19-fgenesh-gene-0.5Conserved gene of unknown function
Pytir_DAOMBR486snap_masked-pir_contig_19-abinit-gene-0.82Gene of unknown function
Pytir_DAOMBR486snap_masked-pir_contig_19-abinit-gene-0.86Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_19-fgenesh-gene-0.26NOL1/NOP2/Sun domain family member 5B
Pytir_DAOMBR486maker-pir_contig_19-snap-gene-0.60Leucine rich repeat protein
Pytir_DAOMBR486maker-pir_contig_19-snap-gene-0.38Protein HIRA

Sequence
11190 bases(100 bases per row)
GATGTCGACATCGACGTAGACGGCTCGGCGGACTTGAGCATTGACGGCTCGGGCGAGGATGACATTGAGATTGAAGGTGACGACATTGAGCTCGACAGCT
CGGCCAGCTTGGACTCGAGCGACGCGTTCGAAGTGGACGGCAGCATGGACGACGGCAGCATCGAAGTGGACTTTGACGACTCGGAGGACTTTGACCAGTC
GATGGAGATCGAGGAGGACCAGGTGCTGGAGGAGTCGATCGACCTCCCAGTTGGCGCCAAGAAGCTCCACCTCCGCGTCGTGAACGGCCAGATCGAGCTC
GACATCCTCAAGGAGGCTGTGGTACAGAAGAAGAAGGAGCCTGTCGCTGTCGCCGCCGCGGCTACTGTCCCGGAGTCCAACCCTGTCGCGGAGACCAAGG
TCACGAAGGAGACCTACGCGCAGCAGGCGTCCGAGTGGTTGAAGAACAACGGCAACAAGCCAGCGTTCCTCGCGGGTGCCATCGGTGCTGCCGTGGTGAT
GGTCGGTGTTGCCGGTGTGGCGATCGCCAAGAGCCGCAAGAGCAAGTCCCCAAAGTCGGTGCTTGACATTGAGGCCGCTGAAGAGGAAGAGCAGGCTGCG
TCAGACGAGGCGGACGAAGACGCGGACGCGAACGAGTCGTCAAGCGACGAGAGCTCTGCCGACGAAGAGGAAGACGAGGAAGTGACCACGGAGGACGCCG
AGGAGAGCGAGGCTTCTCCTGCCGCCGCTGGTATCGTGGAAGGATCGGTCTAAGCAGGCAGTGTGTTGATTTTGTCTTCACCCGTCCGCTGTTCATATCC
AATCCTCCCATTTCGGATATCAATCAGTTAGCACGTGCATGTATCTTTTGAAGAAGTTTGTTTTTCTATTCTCTTTCATCTTTGACTGAGCACGCGCTGT
TTCTGTTTCTGCATGTGTGCTGAGATCTTTTTCCCTTTGTTCTACTACACCTGCCTTTCTCGACCAGTTTCCTCGTTTCCATAGCTGTTTGCTGGGCATG
AGCTCTCCAAGTTTTCTATCAGTTCTTGCATGCTCAACCTCATTTAAATCAGCCACCCCTCCCTCCCACGCCACCATCAAATCTTGCAATCTTTTCGCCG
TCATCACCAGCATTCGCATCTCACATTCAGATCTTCAACAAGTGTGAAAGGTTATAGGTATCTAATGCGCATCCAAATGTGCCGCTTGCTTGTCTATTCT
TGGATATGTGGTGTGCTCCAGTTCGCCGCTGTCAGGCGATTGGTATCGAAGCGGCGGGAGGGCATTTTGTACATCTGAGAGTCCCCATTCTTCTGAAGCT
CGCCTGCAAGATAAGAACACCTCGCGATGGTTTCTGGTGACGTTGTGGTGATCGACCATCACGGACATGGAGTTTGCTAGGAGGCTGACTGTTGGGGACT
ATTAAGTAGTGAAAGGCGGTCATGGCCGCCTCTGGCGCGCACAAGCAGTTCATCCATGGCCTCATCGAGCAGAGCCGTGAGCGCGTCGTGCAGGTGCGCG
CCGGCCAGAGTCTCGTCCTCGTGCTGCACGAGGAGCATCGTCAGCACAGCCCACCGAAGGCCATAGCACCACAAGCGCGGCGCCATCCCCATGCCGGTCA
CCAGAAGAAGACCAATGGCGTCGCTCACAGCACCAGCCTTCCCAACATCCCAACGATGAAGCTCGCGTACGAAGCGCGGCGCCACGCTGACGCCGATGTA
AAGGATAGCAGCTCTGAGGCGCAAAGTGACGTGAGCACCATGCGCAAGAACCTGCGCAAGCGAGGCATCCTAGCGGCCGCGTCCACCACTAGCTCCAGTA
CCACCAGTCTTACCACCACGACAACTCCCACAGAGACTATCGGAAGCCTCGACCACCGTGGCTCGGTGNNNNNNNNNNNNNNNNCGTCCGCCAAGTTCCT
CGAGTATATACTCAGCAAGAGCGCGCAGGTGGAGACGCTGCACCAGAACGACCGCCGCAGGGCGATCACTAGGTCTACTCGGAAGATGGCGCAGCTCGCT
ATTCAACAGTTCCAGTCCCAGTCTCAACTCCAGTCGACAGGACTATCAAGTGAGACCGAGGCGGCCAAGGCGCTCTTTGCGCGTACACTGGCGGCGATGA
AAGGCAAGAAAGCGCTGCTGAGTCTGAAAAAGACGGCGCCTTCACCATCTGAAGTACCGGACCTCGCGAGTGTGAGCAAGAACCCGCACTTTGCGTTCCT
CGACTTTAAGAAAGAAGACAACGACCAGAGGCAACAGCAGCAAGCCGATCACGCTCTCAGGACCGTCGGCCTTGATGAGAGCAACACGAAGAAGCGCACG
CCGATCCACTTTGGCGACCAGATCTGCTTCATCTCCGAGTCTTCCGACCTGCCGCTGAGCATGGGGCCAAACGGACGCAGCTGCCACGTCAGCAATTTGT
CTGCGGGGCTACACATGATGTTCACAATCACGGATTTCAAAAACCCGACGAGACGCAGCGCAGTCACGGCCGACGACGAGTTCTGGCTCCAAGTCGACGG
GTCTCTGATCCATCGAAGTACCAGTGAAAACGGTGAGAGAGATGACTTGGACGTGAGCCGCTTGCTGAGTGAGACGCAGTACTACTTGGGCTGTGCTGGC
TCCATTGAAGGTTCCGACAGTGTTGAGGAAGTCCCAGGTATTCTCAACCACCATCATCACCAATTTCAACACCCGAGCCAGAATAACAAGGAGAACCTAA
GATGTTCGACGCTCAGCTACGCCCTCCCTCCCAGCCACAGTTCCCCACAGAAGACACACAAGACCCAGGGCTACGACACGTTCCGACTGATCGCTATCAA
GGCGACCGTGCCGTCTGTTGAGTACTATGGAGACGACAAGGCTACGCGAGAGTACACGATGGAGACCAACGAGAGTACCATGCGGCTCGCACGGTGGCGC
TTCACGCTCAACACCCACGCGACCACTTTGTCCAGAGCTACAGCAGCTAGTAAACACCGGTCTCAGAACCCTGGAGGTGCTGACTCTGTTGACAACGATG
AAGTCGATAGCACGCTACTCTTGAATTGCTCGAGCGTGTACCTGTCGCTCAACCATTTTATATTGGAATGCGATGCCACACTCAGCAACCGCGGCGTGCT
GCGCGATTACTCGGCGCGGTGTTCAGGGACCGCGACCAGTACTGCGGGTGTCCAGGACGCCACACACCTGCTGAGGCAGCGCGGTAAGACCCTCGGCTCT
GTGGCGTCCTGGCAAGTGCGTTTGCTCCACCAGGCAGTACGCCCACCGCTCTCGCCCACAGGCGCGAAAAGTCCCGTGCCGAGCAAACAGAATCACCAAC
AGCTGGTAGTGAAAGTGCTGCTCGAGTCCCCCACTGAATGGCTCAAGAAGAAACAGGAGACCATCGAGAAGAATGAGACAGCGATCCGCGGCAAAAAGGC
GCTCGCACGCACAGCTAAGCGCTCGTACGAGCGAGTGGCCGACCAAAGCAACCGCAAGCTGGTCGAGATCGAGCAACACAAGGCGAGGCACCACGTCGAG
TACTTCCAGAGTCGCTACCACACGATCTTTGAGGATGAACAGGGCGACAACGGCGGAAAGATCCGCCACCAGCGACATAGAGATAGGGATGGTGATAGTG
GTGGTGATACTAACCAGCAGATCGACAGTCGAACAACCACATTGCTGCTACCTCGAATACGATGATACAAATACACCAACTTCGCATGAGAATGTAAAAC
TATAGAGTTGCTATTTGGTTAGTGGTTTGTTTCAACCGTGGGCACGCTCTTCTGCTTGGACTGCTTGCGCTTTTCACGCTTTCGGCGCTTGCGATTCTCC
TTCTGGGCGTCTGACAGATTCTTGCGCTTCTTGCTGCTGCCATCTTCATCCTCGCTGTCAGCTTCCTCGTCGCCCCCTTCGTCGTCCTTAACAACCACAA
CGACTTCAGCTTGGGCTGGCTTGTTCGCTGTCTTCTTAACCTTCGTCTTCTTGCTGGCATTGCTAGCAGTCGAACGCTTCATCGGCGTCGAGCTTCTCTC
AAAGTACGCCACGAAGAAGCCGTTCGTCGAGTCTTCAAGCCCATTCGCGCGCACTAGCGCCTTCGCCTGCTCCGCCGAGAGTCCTTCGATCTCCATTCCT
CGTCGCGGCCACGTCTGCAGACATGGCTTGAGCACAAACGGTTTCGGGTCCTTCTGGTTCTGCTCCGAGTTGAGCGCCGCGACCACGACTTCTTCGTTCT
CCTTCTGGAAAATCGAGCACGTCGAGTACGTGATGCGCTGCACCTGTGGGAACGAGAACGCCTTGAGCAGCGCCTCGAGCTGGAAATCTGCGAGTGACTG
TACGCGCGCAGCCATTTCGCCCTCGATGTCCTCGACTTCGTTCTCCAGAGCCTCGTCGTGGCCACTCGCGATGTCCAGCAGGTGATCCAGACGGTTCGTC
ATGCCCGAGCCTGAACACGACGGGTCCAGGAGGATGCTGCGCACGTTCGCGTACTTCTTCTCGTGTACGTCAATTTCCAGAAAACTCTGCAAGCACGGCT
CGACAATACCATCCGCGCCGACGATTTTCATGCGGCGCTTGAGAAGCTCCAGGCGCTTGGGCGATCGGTCGAACGCAAACACTTTGCAGTTCTTGTACTT
CTCAGGCTGCTGGTGCAACAGCATCGCGACGTGGCACGTCTTGTTGCCTGGCGCAGCACACGCGTCGATCACGTCGCCCTCGAGACTCGGAGCATCCGTG
TGCTCGCCATGTAGGATGTACGCTGGGAAGCAACTCGCCTTGTCCTGCAAAACCAGTTTGCCCGCGGTCGCCAGTTCGTTCTCGTGGAGCTCCGTGCCAT
GGGGCAACACGAGTAGGTCCTTCACGTCAGTGTCTTTCTCAGCCTTGTACTCGTCAATAAATGCCTGCGTCTCCTCCGGTGTGATCGTAAGTGCATTGAT
GCGCACGTAGCGCGGCAGCTCCAGGTCGCGCTTTCGGTTCTCCTCCGGCAGTAGTCCCTCGTTGGTGGACACTTTCGCCTTGATCTTCATACGCACAAGT
GCGGCCTTGAACGCGTTGTGGAATTGCATGAGCTCTTTCTTCAGGTGGCCACCGCCCTGGATCTTCTCGCGACCAAAGAGCAGGTCGTAGAGCGACACGT
ACAGCAGCGCGCTCGAGCCCTGCACTTTCTTTTGGAACTTGAACTGTGGCACCGCGGCGAGCAGCTGGCGCAGCAGCGGCTTGTAGCGCAGCGTCTCGCA
CACGAGCGCGAACGAGCTGCGCTTGTGCATGACATTGTCCGCGTACGCGAGCGTCTTGAGCCCGCCCTGACGCTTCTCGAGCTTTTGCAGCAACTGCGCC
GCTTCCTTGTAAAGCTCGCTCATGTTGCTGGTGGACTAGCGTGCTTGGAGCGTGGAAGCCTTTGGCAAAATGGGCATTTTCGTTTCGAGCTCTTCATTTT
CATTCGTTCGTTTGCGACCTTGGAACCAATGATGCTATTGAAATAAAATCCTCGCTCTAGTGCCATTGATTTAAATGAGTGACGCATGTATTTAGCTCTG
ATTAGTGACTCTTACAGTCCCTATCATATTTAGTGCCTTTGATGCTAAATAATGACTATTGAGTCAAAATATCAAGACGGCTCATCATTGCCGTCACATG
GCTACATTGTTTGTTCTACATCACCTGTCAATGAGGTGGCAGCGGCCATTGCGACCGAGCGCTTTGACTGCTTCTGGAAGGATTTCGCCGTTGATGGTGT
CGAACTGGTTGCCCTGGATCTCCCTGTTAATGTCATCAATGGCAGGCAGAGTGGGGTCAGCTGAGTCGTGTTGAGAAGAGCAAGACAATGGAGAAACTGT
TCTCACAGGTGCTCCAGGAGCGTCAGCTGGCTCAGAGACTCTGGCACGAGCCCAACGAACCAGTTGCGGTCGAGGCGCAGCACCAGCAGCCCATTGAGCA
GCGATAGCGTGTCTGGGAGCGAGCCTGTGAGGAAGTTGGAGCTCAAGTCCCTGCTCGCAGGAAGGTCATGGTTGTGAGGCTCAAGAGCGCTAAGTTTCAT
CAGGTCTGGGCGTTCAGCAGTCAACCACTTACAGTTCTTTGAGGAAACGAAGGCTCGGACGAGCAAACTCGGGTGGGATGGAGCCCACGAGGTTGTTTTG
TGCAAGACGGCTGGTCATAGACCATCCCAAACAATATTAAGAGGGAAGTTCTGGAGTCAATAGACAACTGAGGCGTGACTCACATGGACTTGATGTGGCC
TGCTCGATCGCACACAATCCCGTACCACTGCGCGAAAGCAGCAAGACATCAAGCACATCAATGAGTATAACTTATACAGCGATGGTCATCAGCAGGGACT
CAAAGTTTGCTCACATACATTGTCTAGACACGGATCGCTCATCTCGTTCTGGATGTCCCATTGGCGCTTCCAGAATTGGCCCTGGGTCGCCCAGAAAAGG
ATCTTCAATGCACCTCGCTCGCTGCGGCTCGTGCCAACAGCAGCACCACCATCCGATGTTACAGAGAGTGAGGCGCTAAGCACCATCAACAACCACATGC
CAACGCTGCAGCACTTGCTCATGCTTGTCGATTTGTCGTTCTAACGTACACGTGCTCACTGCCATTTTTGTATCTAAAGTTAGATTAGCAACTTGGAGCT
GGCTAAAAGAATATCCTCTCACATACGATATCTATTGTGTTGTTAAAGCCCGTGTAATTTTATATTCACTCCACTTTGGCGGCAAAAGCATCATTGCTGC
TGTTGTTGTGTGATAATAAAGCAAGGGAGCGAGCGATGCTACTGGAGAAGCCCGACGACGTCAAGCATGAGAGCTCCTCCGAAAACAGTGCGTCCCGTAC
AGCTACGTACTGTATGTATATGCATACGCAAGTGCTTCTATGTACCGACGCGTGGCTCTCTGTCTATGTCTTGTTGCCGTGCAGCGTGCGCGATTTACGG
TGTGGACGCGCATCCTAGCTACCAGCTCTTCGCCACCGCGGGGGGAGGTGCGCTCCTCCTATTGTTATTGTGTTGTTGCTGATGTGTGTCTATATGCTGG
CACAGCGTATCTTACTATATATATGTGTGTGCGTGTGTACCTGTGCTCGCCAGATAACTCGGTGAAGATCTGGTCGCTGGAGCCGCAGGAGGATGGCATC
GCGACGTTTGAGCTGCTCGCGACGCTCGCGTTCCACCAGCAGGCAGTGAACTGCGTGCGGTGGGCGGGCCACGGACGGTACGCTTTGGCTGATTATTGAT
GCAGCAAGGGCTTCTGCATACGGAGGAAGGCGATGGCGTACTTATCACGACTGTGTACGTTCGTTCTGTACTTCATAGTTATCTCGCATCTGGGTCAGAT
GATCAGCTGGTGCTGCTTTACGAATTGCAGCCGGGACCGCCGGCGCCCGTGCCGTTTGGCTCGAACGCAAAGCCGAACAAGCAGAACTGGGTGCGCTGTT
CGACCTTGAAGCGTCATACCATGGGCAAGTGAAGTAGCTCTCATCATCTGTACCTATCCTACACATCTGGTTAGCTAACTCTTGGTTTCGTTTGTGTATG
TATGTATTTACAGACGTGCAAGACGTCGCCTGGTCGCCAGACGATCGTATGCTCGCGACGTGCAGCATCGACAACACGATCCTCGTGTGGGACATTGGCG
TCGCAGGCGTGAATGCGGTCATGAGCCAGCCGATGCGCACGCTCTCGGGCCACACGGGCTGGGTCAAAGGTGTGGCGTGGGACCCTGTCGGCAAGTACCT
GTCCAGCGCTGGCGAAGACAAAACCGTTCGTCTGTGGAAAGTGGACGACTGGCAGGTACGCCTCCTATATCTCCGTGTTGACTCTCTTGACATTGGTTGG
CTAGACTAACGCTTTGATGTGCTCGAATATGTGATTAATAGGAGACTGAGGTGATCACTGAGCCGTTCGAGGCGTGCGCGTCAACGTCGCACTTCCGACG
GCTCTCATGGTCCCCCGACGGCTCTGCGCTCTGCGCGACGCACGCGTTCAGGTCGAAAAAGAACATTGCAGCGGTGCTCGATCGCGCCACGTGGTCGAAC
GATGTCAAATTTGTGGGCCACCAAGGTGTCGTCACGACTGCGCGTTTCAACCCGAAGCTCCTTGGTGCGAGCTTTGACTATGAGCGGGAATTCTATTCGT
TGTGAGTACTGGCCTAACTGCTATTGTTGTGTGTTTCATGCTTATAGTAACGGAAGTTGCGCCAGACAAGGAGTTTGCATGCTGCGCTGTCGGTGGGGAC
GACGCGACTGTCAGCATCTGGCTTGCGCACTTGGCTCGTCCGCTCGCCGTTGTGAAGGACTGCTTTGATGCGTCCGTGACGGATCTCTCGTGGTCTGCGC
ATGAGTCGATCATGCTGGCGTCGTCGCTCGACGGCACGATCTGCTGTTTCAAGTTCGAAGAAGGCGAGATTGGGAGTCCGATCTCGGATGTGCGCCAGAG
TAAGCTCTTGCAAGCCAAGGTAAGCGGCTGTGTTACTGGCTATTCTGATGCTTTCTGTAAGTGAATGGAACTAACGAACGATGGCTCTACAGTACGGCTC
CCGTGCAGGTATCACTCTCGCATCGACGTTGGTAGAGAACCCGATTCAACTCCAGGTACAACAACAAGACAAAACTATTCATCCTATATTGCTCAATGCG
AACTTCACTCACTGTGTGTGTGATATGTTCCTAGCTTGAAGAGAAATCTAGTGCCTCTACAGCAGCTCCTGTGGCGTTTTCGTCCTCAAATGGCATCAAC
ACTCTAGTCCCAAAGAGAAAAGGGGTTGCTACTACCATCAGCAGTGGTGGAGGTATGCCGCCGCGCCAAGCTGTGAACATTCTGCAGCCTGTTCAGAAGA
AGAGCGACAAGAAGCGCATCGCACCAGTGCTCATGGCGTCGAGCAGCTCGACGTTTTCAGTGCCCGTGCTCTCGCAGCCGCCGCCGAATGCTGCGTCAAA
GGAGAACCACATTCGAAACATCCTCGGCCCGACGGTGTCACCGACTGTGTCGGACGTGCAGCTGCTCGACGCTCGCATGACTGGCGCGTTGGTCAATGCG
TCTCCACACGAAGGAGAAGAAGTGGCGGTTCCTCCAGGGCCTGAGCGAGATGAACGGGCTTCCACCCCAGTATCTCAACCAGCAGCTCCAGTCGCTCCAG
CAGTACCATCGTCTAAACCTGAGACGAAGAAGAGCTCTGAGCTATCTCTAAAGAGAAAACGCGATGGTGAGCGCTCTGCTGCCACTGCGGCTGCTAGTGC
TGCGCAAGCTGTCGCGTCCAAGGCGAGAGAGCTGGCTCCACGGCAGCCAAAGTTGCTGAATAGCAGGTACCTTTTTGATGTGTAGAATCCTCCTCGCTCG
ACATTGTCGTTCACGATTAACTGTTGCTTATGCCTTCGTTATTGCCCAGTGAAAGCGTCACTGCGAGCGGCGCTCAGCTAATGCCTGAATTCCCCCTTCG
CCTTCAGTTCACAATTGAAATCGACATCTCGGGCAGCAACACCACGCGCATTGGTGCAACGAGTGATGCGCCTTCGACTGTCGCGATTGAAGTGAATGTG
CACAACGTGAAGAACCCTCAAGCCGAAGAAGCAGTTGGTGCGGTAGCTTTCAGCTTGCTGATCATGATGACGAGATAGGAGTGTGCGATGGAGCTGACTG
ATTGCGCGATTTCTTTCTTTCATCAGGTACAGAACTAGGACCAGTGTACTCGAGCATCCAGTGCTCTGCAGCTGGCAGCGTCAAGTGGATCGACCGAATC
CCCGGTCGAGTCGTCCATGCGGTGGGCAACGCCACGTTTTGTGCGATCGGCGTGGACAACGGCGACCTGTACATCGTTAGTCTTAGTGGACGGCGGCTAT
TCCCGTGCATTGGCGAGTGCTTTGTGTGCTGTGACATGAACGTGAATATTGCGTCGTGAATCTAATGCGCTCGTCTCTTTTGTTGGTCGGTATTATGTAG
CACTGGGAAGTCCGTTCTCACTGCTCGAGTGTAGCCCCAAGCAGTCCTCGTACCTGCTGGTGATCCTCGCGACCGGCGCCATGAAAGTGTGGCACGTGGG
CAAGCGCAAACTGGTGCTATCGGAATCGATCGAAGCGATTACGAATGCTGCCGACCAAAGCGACGCACGTCGGCTGACTCTGTTGAGATGCCACATCACA
GTCAAGGGTCAGCCGATTCTGACGTTTGCAAAGTCCAAGTCAGACAGCAAAGTAGCCTCAAGCCTGATCTCGTACACCTTTGACTTGTCCATGGGCTGTT
GGTACGTTTCCGATGATCTACCAGTTGGGGGTGGCTGCGTTGCTAATTCACTTTATTGCTCTTTCTTGTCATTCTATAGGATGCGAGTCGCAGACGATAG
CTTCGTGTTCTCGGACTTTAACTCTTCATTGCCAACTGATGCAGTCACCATCAAGGACATCCCGGTACGAACTTATTTGATACATCTGTACTCGCTACAG
TTGATGATATGATGATTAACATATCATATCGTGGCATGAGCAGGTCGGACCACTTCGTCGTTTGCAGAATGCATCTGGGTACAGTCGCACGCAACGCGGC
ATTGCGTCTGCGATGCTGGACGGCATGACCGACGCCCTGACGCAACGGAATGTGACGCGGTCCCACTTGGAGCATCAAGTGGTGGCGTCGATCTCGCTGA
AGAGCCCGACAGAGTATCTCTACTGGTAAGGGAGAGAGACGATGGGACACCATGTGTTGCTTCTGTATCCGCTGTTTTGGTTCTAACTGGTCAAACGTAT
CTATCTGCTCATGCGCACAAACAGGATCGAAGCGTATGTGCGCTTCCTGGCACAAGACGAGGACGTTGATCGTCTCGACGACCTCTGCGCAGACATGATG
GGACCTTTCCATGCGTACGTATTAATCTATTTGTTCCTGATAGTTTCAATGAGACTGACAAATTTCGCAATGACTCTAACTACAGACCGTCATCGATTCA
AGTGAACGGAAGCTCAGATGCTGACCCATCTTCTTCTAACGAGTGGAGCCCCATGGTGCTGGTACGTGGGTGTTAGCAAATGTGGATGTTCGCATCGTAC
ACTACTAAGCGGAGTCTCAAACTTGGCTGAATTTGCTATTGCTATTGCAGGATCAGAGCAAGCGCGATATCCTAAAGACACGCATTTTACCGACCATGGC
GACGAACCGCACTCTGCAGCGCGTTGTGACCAAGTACCAGCTCATGTTGAGTGAGATCACCGCTCGCGAAGCCGACGATGACGCAGATGA