Description :
From Genome Similarity Track
Location :
Scaffold_24:43361- 48357
Transcript NameFunction/comments
Physo_133045hypothetical protein
Physo_133046hypothetical protein
Physo_133047hypothetical protein

Sequence
4996 bases(100 bases per row)
GTGTTGACTCTCTGCGTTTGTCGTATCTGTTTTGCAGCAACCGCTTCTCCTCAAACGCCAACGCGAAATCTTCGCTCGGAGTTTGGCCAGTGCGATGCAC
CTGATAGCGAGCGAGTACGAGCCGTCGGGGAGTGATGAAGAGGAACTTGAAGAAGAATCGAAAGAGGAAAGCGAAATGAACGAGGATGATGAGGAAACCA
AAGAAGACACACCAGTTTCTGTTGGTAAGTTTATTGTGTACATACACATACATACACGATACCGATACATTTTACTGACTTCTATCGTGTATCATACAGA
TGATCCAAACATCATGCAGCCTGGGGAAGTCGTTGACGACTACACAGTATTGGATTCAGATGGGGAGAATGGAACAACCTCTGTGTTCGGCGATGACGAA
GAATTGGCGCTCACGGAACCGGCTGCGGAGGTGGCAGCTTCGGCCTCGGATCTTCATTTCAATCCCTCACTGCTCGAAACCGTGGGAGGGTTGTCAGAGA
TTGCCCACGGCAGCGTGCCCAAGGACGTTCTGGCGGACATGAAGTTCAATGGATGGACGGAACTGACCAATGTGATACCCTACCCGTACATGCACCAGCC
GTACAACGCGCGACCAGACGGCTGGATCAAAGAAGCCTACCAAACATCTATGAAGGAGAACATGGACCTACAGCCGATGCAATTGCTGCGGCATTGACAC
CGTCGGGAGCTTTCTTTCGCTTTGTACCGCCGCACTTGTGGGAAGCTATTGCTGGAGCAAGTGATGACTACTTCAAGGACAACCTGGACCTGCGAGCAGC
TGCCCAGTACGCCAAGCAGCAGAAACGAAAGGAGAAACATCCTGATTTTCAAGTTCAGACGCCGCAACAAATAAAGGAGTTTCTGCAAACTACAAAGGAT
ATCTCGGGCAGAGAATTGTGTGTCTTTATTGGTTTGCTGATCACCAGCACCATCGCGCCGTAGTGACCATCGCGCCGTAGCGAAGGACTATCAAACGTAC
ATGGGCGGCGTGGACGTACATGACCAGCTTCGACTCCAGAGGTAAAGTGCTTGTATCGTGTATGTACAGTTTTATCAATACTGATTATCGTGTATCATAC
TGCTTTATTACAGATACTCTCTTCAAAGGGCCAGACGCTACAAGAAATACTACTAGTCATTGTTCCTGGGTCTGATTGATCTCGCTATCATCAATGCTTC
CATTGTGTACAACTGGCGCCGCACCATGGATGGCAAACGCAAAGCTACGCACGTCGAGTTCCTGAAGAAGCTTCATTTGGAGTTGATCCAGCTGAAGCCT
GACGACTGGACCCAAATGCTGCGCCACCGCGGCATGCACCCTACACCATCGAAGCAACGCAAGGCTACAACAACTCATGTACCCGTACCAACCGACGAGT
GGAGGAAGGGCAACACGGACGACACGAGAAAGCGACGCCAGCGTGCCTGCAAGGTGTACTCGGTGCTCAAGCGCGCTGGCGAGGCGAGAGGAGGCGAGAC
TACGTTCTACTGCGGTGGCGGCAAGCTCAAGACGGCGGCAAAAAACGCTCATACTGCACGAGTGTTCCTGTGCAACAAAGTCAAGCACACAAGTAATGGT
GAGGCAGTTCCCTGCCTCGAGATTTGGCACCGACACTGGAAGAACGGTACCGTGATCCCGCCGTCCATTACCAAGCGCAAGATTCGCGCACGGAAGCCGG
CGGCGACAGCTGCGGCCGCAAGTGACGGCGGCAGTAGTGACAGCGATGCCGCGTCTGATGGGAGTGCGCGCGCGATTCAGCAGCACAAGCGTGCTTGACG
AAATGCAATGTAGTGTGTGCAGCAGCTCTTCTGGCTTTTTATTTGACTTAATTTGAGTATGCACTGGTGTTGCTGATTGCCATCTGACTTGATTCTCTAA
ATATCGACAAAAATTTGACCTTACGACTGCACTGTTTTTGTACTTTGATACACATTAGTCCCCCATAAGATGTATTACCCAGACACGATAATGCGCATAA
GACACGTTAGAGCTGAGGTGGCAAGTTGGGGTTAGGTGCATGGACCGGCTTTGGGAGATACACGTTTATAATAGTGTGGACTCCACTATATGTACCCAGC
ATGAGATAAATCAATATCGTGTATAGGATTTCGGCCAACGGTGGGAACTCAGATCGCTCGCGCTGGAGGGGTTAATGGTTTCGACACGTGGTTCCAATTA
CGGATGGTCAGGCATCCCGAAAAATAATAATGCCCGAAAATATAACAGTATTTTCGGATACAATACTATATTTAGGGCATCACCGTTTGTTTTATCCGAA
ATTTATGTAGCCGAGTTCTAAAATTCGGTATTTTACTTCTGCTCATCCTGCTCCAACCATTAGTTGTGGTCAAACATCGCAACTTTGCCGTTAGACCCCA
CTTTCAAACAAGCACCACCCAGCACGCGCATCACGACTCGACGTTAGCACCATGACCGACAATCTCCTCGCTGGCCCCGCTCCGAGGCCTACCTTCTCGC
CCAGGCATATTGCTGCCTTCTACTTCAAGCCCTGCCTGGACGAGGAGGGAGAGACGACGGGCTACTATGCCTGCAAGACCTGCGCTAAGCGCCGCAAGCA
CGCGCCTAAGTCAGGCTACAGCAACTTGGTGTCGCACGTGCGGGCGGCGCACCCCAACTACGAGAGCGACATGCGCGACGCTAGTGTCGCTGCGACGGGG
ACCCTACTGCCGTGGGTCACCCAGAAGGCCTCGAACCGCTACGCGTGGCTGCGCTGGGTCGTCACGGGCAATCTACCGCTGTCTTTTTGCGAGTCCAAGG
AAACGCGACAGTACGTATTTTCATATCTATTTTGGTGATTTACATGTGTGCTAATGCCGTATGTTATGTAGATACATGAAGCTAAATCCCATCTCCGTGG
AGACGCTGACCGCCATCATGGAGACCGTGACCAAGGCCGTAGAGACGATGATCGGCGACGCCATGCCCGAGCGTTTTGGTCTGGTCCTTGATGGGTGGAC
CCACGGCACGGAGCACTACATGGCAGTGTATGGCTGCTTTGAGACGGCGACAGGCCCCCAGTACCCGCTGCTGTCGTTAGCGCCCGTCATGGATGAGCCT
GACGACCAGCTGAGCGCTGACGGCCATCTGACGGCGATTAAAAGGTTCCTACCCTTTTTTGGTAAGTCTATCTCCGGATGTCTATTCCTGGTTGGTGACA
ACTGCGGAGTAAACAAGCGACTGGCGAACCTACTCGGTGTGCCGCTAATCGGCTGTGCCAGCCACCGCCTGAACTTGGCGGTGCGAGACTACTTGGAGCC
CCACGACAGCATCCTCGAAGAGGTCCAGCAGCTTATGCGTAAGTTGCGGACTTTAAAGCAAGCAGCCAAGTTGCGGTAAGTACTCTGTTTGCTGTTTAAT
TTGGTTTTTGTATTGGTACTAAATTGGTCTTTGTTTTTGGGTTTTGTTCGAAATTAGTCATTGGCCGCTGTCCTCAGACAGGACACGCGCTGGCCGTCGA
CCTTTTCAATGCTCAAGCGCTATTTTCGGCTCCGTCCGTTCATTTCGGCGGACGACGAGGAGCTCGCGGACTTCCTTCCGTCACGCTCAGCCCACCGCAA
GCTGGAGACTTTGCTGGCAAGCCTCCGGGACGTCGAGTCCGTGTCCAAGCACCTGCAGGGCGACGGCCTTACGCTGCTGGACGCTCGTGTCCTATTCGAC
GAGCTCCTCAAGAGCCACCCCTCGTTCGCGAAGTATCTCGGTAAGGATCATCGCTCACTCTGCGTCTGATGGTATTTCTACTTAACTACTGCGTTTTATA
TGTTTTTATTTATGCATAGCCACCGACGCGGATATAGTCCACTCCGCCGTCTTCGAGCAGGCGGTCGTCAAGGTGCTTGACGACCAGGCGGCCCTGCTGA
CGGACGACGAAGTCACTGCGCTGGAGCCGTTCAAGCGCACGCTGGCTCATGTGGAAGGCGTGGACTGCACGCCGGCGGACAAGGAAGGGTTCGCTGTGCG
TGCGCTCAAGCGACGCAAGGTAGCTGCTGCGCCGGCCACGTACGAGCTGCTTAATGCGATTCCTCCTACCTCAAACATGGTTGAGAGGCTCTTCAGCATT
GCGCGCGCTATGCTGCGCCATGAGCGCCACCGCCTCTCCCCCATGATCTTGTTCCTCAAGATCAACAGCTCGTACTGGGATGTTGCGACCGTGGAGCAGT
GCCTGTAAGTAGGTACAGTCGTAACAGGATTGCAGTAATTTACTGTGTCAACACTATGCCTCGCGTTATTTATTCAGTCTGCTACTCGGATGCTATGCAA
TATTTATTATGGTGTCCGGCAAACAATAGATATATATCGTATTTTCAGCATGCCTGCGGATGGTCGGCCATTCTCGTTCGGTCTCTTGTGGTGTGGTAAT
ACCACTTAAATTCTCTTCTACCAAAAGGTATTAGAGACACCAACAACACGCTAACCCGCAAAGGTAAGCGCTTATTGGATCAAAACCTGAAGACCAGGAA
CGATCCCTTACACCGGGTCGGTTGCAAGCGCCTCTGTGCACCTTAGGTTATCTTCGGTCAACCCAAAAACCTGTACCACTAGCCACGAGCTAAGGCTAGG
ATACTATGTAGCGCTTTCGCGCAACCCCACTGCAGTCCCTCAGAAAGGAAGGGTACCGGCGTGTTAGGCCTTATACAGGGGGACCAAGGTAAAACCTCGG
TAGGTAGACTAATACACTCAGGGACACTCTAATCCCACAAATATATACTGAACGATACTCTAATACCGTTCCTGCCTCTCCGGCCACGCCAACTCTTGGC
GCTGCCAAGGAAACTCTCGGTCAATGCACGATAAGCTCCCCGACAGGCATCCACACGCAGCCGAGCGTGTCCAGGCACTACACTAAGCTAGCTACACTTA
CCGAAGTCGGACTTGACCTTTGTTGGCTTTGGGGGAAGACTGTCTTTTTATTACTGAGTTTTCTGAGGCCCTGGGGGCTTCGTTCTGGTCATCCTA