Description :
From Genome Similarity Track
Location :
Scaffold_130:4335- 6135
Transcript NameFunction/comments
Phyag_g2489hypothetical protein PHYSODRAFT_531070

Sequence
1800 bases(100 bases per row)
TCTCCGTCTCCAGTGCTGACGCCCCACTTGACCCCTCCGTCACTGGATATATTAGCACCAAGTTGTGGGATGAACGGCCCGCCAAGTACGCCAAGAATGT
GCTGAAGAACGTGTGCATCATCTTGTTCATCCTGTCGGCTTTCAGCCAAGTCACGAATTTCGCAATCGCTCAGTCGCTCAAGAACTTTTTCCAGAAGCTG
GGATGGTCGAACAAgggctccacctccatggAGCTTACGTTTGACTCACTTTGCCAGTTCATGTGCATCATCGCGGGTTACATCTCGGATGAGCGTCTCG
GAAagttcaagacgctgttgTCTGCTGCCACTTTGGACTGTGTcggtctgctgctcctcgttgttgctgcattaCCCGCTATCCTGAGCCACATTGGAGC
AAGCAAAGCCATTTTCAATGTCGGTTTGTTTCTCGGTGTCGCTACCTCCCAAGTGTGCCTTCGGCCGCTTGTTATCTCGTATGGTGGTGACCAATTTTCA
CCTGCTGCCCCAGCTTCCGACAAgactctcttcttcagcatccagTATGCAGTTGCGAACGTTGGTGCGTTTATTGGCTACGCTGCATTCCTGTATGTGG
CTATCCATGGTTTGGGTGCCATCCCCGCGGACTACGGCTATGTCAGCGTGTATATTGTTGGTTTTGTCATGGTGCTCTTGTTCCTGGCAACGCTTTGGAT
CTCGCGCAAGCGCTACGTGAACGTGCCTCCAACAAGAGAGTCGATCGCTCTCGTGATCAGAATTGTGACTGAccacgccaagaagagcttcaccgCAAAG
ATGGTCACTCTCGGCACGATCCTGTATATCGCCGCGTTTGCGTTGAACATCCTGGTTTCGTTCTTGTCGGACCACGGCGAGGTAGGCCACAACATTTCAT
ACGCTTGCGGTGTCATGATTGTTATCGCAACGGTGATCTGGGTCTACTTCGGCCGCAGTTCCGCGTTCATGGAGAGCGCCAAGGACACTATCGGTGACCG
ATTCGACAGTGAACTTGTCGAAGGGGTGTAGCAGGTCGTTCGGATCCTGCCTCTCAACGCTTTTCAAGTTGTGTTCTGGATGTGCCAAAACCAACGGGGC
AACAACCAGTCTATCATCCAGCAAACCGACGTGCGTCTTGGCAGTGGTCCCGACGCGTCTCAAATGCCGGGTCCAAGCGTTCAAGCTTTTAACCCTGTGG
GGTGCATGATCTTCGTTCCATTGACGGAGAAGGTGATCTATCCACTCTACACGAAATACGCAGGAAAGCCTCCGAGCCGTTACGGGAAGGTGTTGGCCAG
GTACTGCGTCGTGACCGTGGCTATGATCTGGACGGGCTGTTACGAGATCATCCGACGCAACGCTGGTCCACTGACGTACGTGGATACTAGTGGGGAGAGG
CAGTTCATCCTGAACGACGACGGTGGGCAAGTGATGAACGACATTCCATGGTGGACGGCCATTCCGCAGTATCTGCTCGTGGCTTTTTCGGAGGTACTAG
CGGCCGTCGCATCCTACGACATCAATTACTCAGAAGTACCGCAGAGCATGCGCAGTACGTCGATCGCAttggccttcttcgccaactcAATGGGCAGTAC
GCTGCTCTCGGTGCTTGTTCTACTTTTCGGCAACTCCATTCCGTCCAACCTGAACGATGGTCACATGGAATATCTCTACTTCACACTTGCAGACATTATG
GCTCTGACCATTTTCTTCTACGTGACAGTCATGAACAAAATGCAACTAGGAATGCTTCCTCCCGTCGACAACGAGGAGGACAACAAGGAGGACAAAGAAG