Description :
From Genome Similarity Track
Location :
Scaffold_172:43344- 46033
Sequence
2689 bases(100 bases per row)
TTACCTCCCGATAGAGGTGTACGTCATGAAATTGACCTAGTTCCAGGAACTAAATACTGCGTAACACGGCAGTGGCCTTTGCCTAAGGAACAGTGTGACG
TCATCGACGATTTCTTTCGTGCTAAGCACGCGGCAGGAATCGTGCGGGAGATTAAGTCTCCCCATTCCACACCTACATTTTGTGTCAAAAATCCTAATGG
TAAGTGGCGTATTGTGCACGCTTATAATAAGCTTAATGCTGCCACTATCCCGGCTCAGACACCAATCCCCAGAAAGGATGTTCTTCAGAACAATATGGTG
GGATGTACATTGTACAGTGCGCTCGACTTAGTCGATGGTTATTACCAGCTGCTCATGCGAGCAAGCGATATTCCGCTAACAGCGGTTAGTACCGCGAGCG
GTATGCTCTGGGAGTGGCTCGTTGTGCCACAAGGGCTGTCAAATGCACCGGCTACTTTTAATAGTCTGGTGACGCAACTATTCAGACATCATCGAGGCTA
TGCACAAACGTACTTTGATGACATCTTTGTCCATAGTCGTGCAGCGAACGGTCGAACCGATTTGGATAGTCACATTGATCATTAACGAGCGGTGCTCGAG
TGCATGCGCACAAATAAATTGTATGCAAATGCATCTAAGCGCATCTTTGGTGCAGAAGAGATTCCCTTTCTGGGGTGCTTCAATGGGAAGCGAGGCCTTC
GAGCGGACCCCGCTAAGGTAAGGGCTATAGTCGATTGGCCGGTTCCAAAGAACCAAAAAGATCTACGTAAGTGGCTTGGCCTTGCCAATTACTTGCATAA
GTATAGTGCAAATTACGCAGATATGGCTCGGCCAGTATTCAATCTCCTTAAGAAGGATGTGGATTGGTGTTGGGGTAACACCAAACATGAGGCTTTTCAA
GAAGTTAGGGAAAGTATCCTTCATGCGCCAATGCTGGCTTTGCCCGATCCTGATCGGCCTTTCAGTGTTGTCTGTGACGCATCTGACTTTGCCATAGGCA
GTGCTCTGTTACAAACAGATGTCGATGAACGCGAACGCGTCATTGCATTCGAATCTGGACAGCTCAAAGCTGCTGAAAAGAACTATCCAGATCATGACAA
AGAGCTACTTGCTATGAAGTACGCTCTAGTCAAATTCAAAGTACATCTGCTTGGCTCAAAGCCATTTGTGATCGATACAGATCATGCATCATTGCGCACT
GCGACACAGTTGCCGCATCTCTCTCAGAGAATGGCTCGTTGGATTTCATTCTTTGCCGAATATACTTTAGAAGTGAAGTATAAGCCAGGAAAGCAAAATG
CTTTGGCTGATGCGCTATCGCTCCGACCTGACTACGAGCTTGCTCACGTAACTACGCTGTCATCGTCAGTCACTAACTTAATCCGTGCGGCTTATGCCAA
GGATGAACAAAGTGTAGCTTTGCTACGTGCTTTTGGGAGCAAGGAGTTTAAAGACTCGGACATAGAATTGTCGGCACGTTTACGTGCGAGACTACATCGA
TAATCCATCGATAGTGGCCTGTTGTGATATCGCACAGATATTGAGGATAACCCTCGTATCTCTGTCCCCCATGATGATGAGTTGAAGTATCGAATACTCT
ATGAGGCACATGATACCGCTTTAAGTGGTCATCTAGGTCGTGAGAAGACCTATAGCTCAGTGATCCAGGCTTATTGGTGGCCCAAACTATACAAGTGGGT
GAGCACCTATGTGCGTACGTGTGAAAAGTGTCAACGGGTTAAACCCTCAGCACCTGCGGCGGCACCTCTGGCTAGTCTGCCTTTACCCACTGGGTATTGA
AAAAGTCCGTGAGTATGGACTTTGTGTTTGGCCTACCGAAAGATTTGGAAGGCAATACTGGCATTGTGGTCTTTGTTGACCGATTGAGCAAGATGGCTCA
TCTAGAGGCAGTGCCGGATTTGACTGATGCCGAAGGTACAGCGAAGCTGTTTATCGACCGCGTTTTTCGACAACATGGCTTGCCAGTGGCAATTTTCTCT
GATAGAGATCCCCGCTTCACTCGGAAGTTTTGGAAGTCCATCTTCAAGGTGCTCGGCACCCGTTTGGACATGTCCACAGCGGATCATTTGCAGACCGATA
GTCAAACTGAGCGTGTTAATCGCGTTATTAATGACATTTTGCGCAGTGTTTGCGCTGATACGCCTAAGCGTTGGAGCTCCATGCTCCCTCTTGTTGAGTT
TGCGTTGAACTACGCTGTTCATGCCTCTACAGAATATACTTCGTTCTACGTAAACGGTCTCACCCACCCTCGCGTTCCGTTAATGCTACCACTATGTGGT
TCAGGGCTTGGTGGCGGAGAGGTTGCCGATCGGCTTCTGATATCAGCCCTGCTACTGTTCAAAAAACAGGTAGGCGAGTTTCTCGCAACGCAATTAAATG
TCTTAAGACATGTGCGTGACGCAATGGCTGAAAGCTAAGACCAACAAAAACGAAAAGCAGATGCTAAAAACAGAGGTTGTATTGAACGTTATAAGGTCGG
AGACTAAGTATTACTCAATGTTAAAAGTCTACCTACAAATGTAGTGTCCGCTGTCTTTAAGACAAAGTTGCGTCCACGCTTCGTTGGACCATTCACGGTC
GTTGCTAAGAAGGGACTTGCGTATACGCTCAACCTTCCACGCACATTGCGCACACACCCAGTGTTCTACGTTGGCTTGCTTAAGCCGTA