Description :
From Genome Similarity Track
Location :
Scaffold_178:43336- 46785
Transcript NameFunction/comments
Phyke_g5980hypothetical protein PHYSODRAFT_560962
Phyke_g5981hypothetical protein PHYSODRAFT_545950

Sequence
3449 bases(100 bases per row)
TTGTGGCACATGGGTCTGTACTTAAATTCGGCGGTTCTTCACGAAGTTACACGTTTAAGGTAAGTCTAACCGCTGTCAAAATGTGTAGCTGGTTAAGGGA
AAAGTGGCAAACGTTGGCTGACATGTTACCCTTGTTATGTCATTATTTTAGTCATTTGATTCTAGGGAACAAATTGCCCAAATTATCCATACTCGCGCGG
GGCTCCCgaatgaagagctggaaTTACAGCAGAATACGATGCTTAATTCTCAGATTTCGCACAGGTTAGAGCTCTCTCCCAGTCGACGGAGTATGCCACC
AATGTTCCCAATGGCGCCAGTGGGTCAAGTTCCAGAATTGCAACCTCAGCACGACACGTTGATGCTGATAGCCCCAAATATGGGTGAATGTGATCGACGA
GGTAGTGCTGATGgtgtgcagcttctgggtCTGGCAGGGATTGGCCCTGTTCGGAAACGTTCCCGTGGTCAATCTGGGAACTCACAGGCTTCCTCCGATC
AGAGTGGCAGTACTGCAGATCTGAGTGTGTATCTCGACGACCCAGCCGACGAACAACAAGGTGAACCGAAGCGTGTTCATTTTTGTGGTCAACCGCCTGA
GATCATCCCGGATGCGATGGATGAGGGAGGTGAGGAACCAATTGACATCGACTCGGATGCTGTACAAGTTCGTGAAAATCTTCAACGCACAGATTTGGCC
AACACCGATTGAAAAATTAACAGGTTTTTATTCTGGATAAGGGGAGACGAAGACTGCGAGGTCCCCGACGAATCACTGCAAATGCCCAAGGTCGACTCCA
TGGGGCGTCTGCACGAGGAACGTTGCCCAAGAGGCGAGAACTGTACAGGGTTCTTGCTAACACAGTtcaggcagcagcacgagcgcTTTGACGACAAGCT
GCTTGAAGGCAGCAACTTGAATCGTCAAGGCATCGTCGCTGCTAGGAGAGCCCAGGTTCACCAGTAGGAAGTGAAAGGGTTCAGGAGACGCCATCCAGAT
TGAGAGCATCCAAGGCAAGATGCCCTCGGCACTCGTGAAGAATGCCGGACCTGGAAAAGAGTCGACTCCCATGTGTGGGATAACGTCAGTTATTATAGTT
CGTAAAGCAATTTGTAGAATTCTGCGGCAGTTCAGCATCAAGTGCTCAAaagatgaaggagcttgGCATGAGTGAGGCCGTGATCAATCAATAAAAAGGG
AAAATGAGGAGTTGAAGTACTTAAAGTATTATGCATTTCTCTGATCGTTGAAGGTCAACACGATCGTTTGTTAGCGTGTCAAAATAATCGTGTTTGCTTA
TCGTCCAGCAGAATCGCTGAACGTGATCAAGGCAAGCCACAGCTGAACTGCAAATGTAGTAGGAAAATTATTCGTTGGTATTACCAAGTCAATCAAAAGT
ATGCAATGAGCAAGATGCAATGTCAAACAAGACGCTAGCTAGCCTGCCTGTGGTCGCCAGCACCCTCCTACTCGCATAGAGTACAATCCTCCATCTTGCT
AAGCCTACCACTGTCGCGCACCATTCATCTACGGTGCGCTGCCAGCGGGCGACTCGTACATCTGGTAGTTCGAGTGAGACTTCGCGCGAGAGCGGCTGAA
GTTTCTTGAACGCGCACTGCCCGGCGTGCGGGCGCTGCGTCGAGACGCACGGATGCGGCGTATACGTGCCCGCTccgcctccatctcgcccTTCGTGCAC
ACCATGCCGTTCTTTAGTGTGCCAACGGCGATCAGAAGCACCATCGCCACGATGCAGCAACCAGCCAGTGCGAACATGTACAAGTATTCGTCGCCGCTca
tcgaagagctggagcggATGAACGTGGCACACACCGGCATCAGGAAGAACACCATGAAGTAGACAGTCACATACACCGCGCGCTGCCTGGTGTTGAAGAG
GCCAACACACGACACCCAAGGCACCGACGTGATGCCCAGACCAGCGAAGAAATAGAGCAGCATACCCAcgatctgcagcatcaggTACTCATCGTCCCCA
GTCACAAACTCCGACTTCTCATTCAGTCCCAGAACGAACACCAAAATGGCCACTGGTAGCAACGTGCAGAACAGGATACGCCTGTGGTCCACTCGgtcca
tgaagaagaacgagaatAGGGCACCAAGGAACTGTAGGCCCATGCAGTTTACGAACATGTATGTCGCATCCTCGATGCCGCGGAAGGTATCCGAGAGATA
CATATTCACACAGCCCAGGAAAATACCCGACACTAACATGAGCACCAAGCCCATCACGAACTTGAGGAACGACGTACCACCGTTGGCACTCGAGTcgtcg
cttccagcttcCTCGTCACGGATCATACGCAGCTCCTCAGATACACCTTCCTTGCGGCGCAACACGGCAAGGCATCGCTCAGACGACTCCAGGCCCTCAC
GCATGTACACCCAGTAGGGACTCTCAGGGAAGATGTAGACGGCAGGGGTCATGATGGATAGGATGATGGTCGCTATGAACACCTGCCACACCCAACCAAC
TTCgttcgacgacgaagaaaaccATGCGGCAAACAAGATGCCGAGAATGAAACCActgccgagcagcagcaacgctTTGCCACGCATATCACGCGTGGAG
ATCTCGTAGATGTACATAGCCAGCGTAGGCAGAAGTACACCCACGGAAGCACCCAGTAGGGCAATACCAGGCGTCAGGAAGCCTTCGCCACCCGACTGCA
CAGCACTCACGCCAAGCATGCCGACGACAGTCAACAGACCGCCTAACACAATCGTCAGCCGGCGACCAATGAAGTAGCTCAGGAACCCGGCCGCAAACGT
ACCGACGAGGCAGGCAAAGTAGAACGTGTATGTGACCGATCCGTCACCAACGTTGCCGTCAAGCAGATCGTACGTTGTCACATAACTCAAGAAGCCAGCC
GTGCTCTCGAGGATAGTGAACAGGTGGAACAACCAACCGCAGCCGATTCCGCCAAGCACACCCATGAAAGCGGCCAGCGAGAATGCGTACTGCGACGAGG
CAGACACGACCTCCGAGAAACCCTTGTTATACATCATACGCGTCTGGATGATGTTCAGGAATGGGATAGCAGACATAACCAGCAGTGGGGCGATCATAGT
CACCGAAAAGacgaagtcgaagaagaacgcTAGCTGCTGGAACATACCAACAGACGCGACGGACGAGTTGGCGAAGCTCCACATGCGCACCATCTCGTTT
ATGCCATATAGAGCCGCCATGTAACCGTAGAAAAGAGACATCGTCCGCGTGAAACTTGTATCGGAGATCACAATCGAGCCCACGAAGAATACAATAAGTG
CCACGAGCAGGACGAACACATACATCATAGCGCGAACTGATGAGTTGACGTTGCGGAAGCAACTGCCGACCGCACCAAAGAAACCCATCGCCACCACAGT
gaccacagcagcagcgaacACCAAGCCCACGGAGAGGATGTCCCACTCG