Description :
From Genome Similarity Track
Location :
Scaffold_2:433210- 441065
Transcript NameFunction/comments
Physo_108178predicted protein
Physo_127509hypothetical protein
Physo_127510hypothetical protein

Sequence
7855 bases(100 bases per row)
GCCCACTTCCGAAAATGGCGTCCATGTTGCTCCGCCGTCCGATGCTCGTGCGTAGGGCGCAGCGCTCTCTGCCCAGCGCCCTTGTTTCCCGTAGCTTCAG
TGACGCCGCTTCTTCCGATGCGCCGCAGCGTCGCGTGTGCGTGGTGGGCTCGGGCCCCGCGGGCTTCTACGCGACCAAGTACCTGCTCAAGGAGCACGGC
GGCGCGCGCGTGGACATGTTGGAGGCGCTGCCCACGCCCTTCGGCCTCGTGCGCTCGGGCGTGGCGCCCGACCACCCGGAGGTGAAGAGCGTCATGAACG
ACTTCGACAAGGTGGCGGCCGACGCGCGCTTCCGCTTCCTGGGCAACGTGCGCGTGGGCGAGGACGTGACGCTGGCCGAGCTGCAGCGCCACTACCACGC
CGTGGTGCTGGCCTACGGAGCCGCGGGAGACCGCGAGCTGGGCGTGCCCGGCGAGCAGCTGCGTGGCGTCATGTCGGCGCGCAGCTTCGTCAACTGGTAC
AACGGCCACCCGGCCTTCCGCGACCTGGAGCTGGACCTGCAGCAGGCCGACACGGCCGTCGTCATCGGCCAGGGCAACGTGGCCGTGGACTGCGCGCGCA
TCCTGACCAAGAACGTGGACGAGCTGGCGACGACCGACATCGCCGCGCACGCCGTGGAGGTGCTGCGCAACAGCGGCGTCAAGAAAGTGTTCCTGGTGGG
GCGACGCGGCAGCGCGCAGGCAGCCTTTACCATGAAGGAAATCCGCGAGCTGACCAAGCTGGACGGGGTCGCGTGCGTCGTGGACCCGGAGGACATGAAG
CGCAGCTTGACGCCCGCGTCCGAGCAGGAGATCAAGGAGCAGCGCGCGCGGAAGCGCATGAACGACCTGCTGGTCAAGGCCGCGGAGCAGTTCGGGAGCG
TCGCCGACGCCAAGCGCGTCGTGCAGATCAAGTTTTTGAGCTCGCCCGCCGAGATCCTGCCGGATGCGAACGATCCGACACGAGTGGGCGCCATTCGTGT
GGAGAAGACCAAGCTGGAGGGCGAGCCCAACCAGCAGCGCGCTGTGGGGACGGGCGAGTTCGAGGACATCCCGTGTGACCTCGTGCTGCGCAGTATCGGA
TACAAGTCGCTGCCCATTGAGGCAGATGCGCCTTTCGACAACCGACGCCACGTGGTCTGCAACGAGCAAGGGCGAGTTGTCACGACCTCGGACAGCGGAG
AGAAGCAGCCCGTGGTGGGCTTGTACTGCACCGGATGGGTGAAGCGCGGCCCCTCTGGTATTATCGGCACCAACATCGTGGACGCACGGGAAACCGTTAG
CTGCATCGTGGAGGACTTTGCGGCAGGCAACTTCCTTCACAGCGAGGCAGGCATTGACGAGGAAGTGGGTGGAATGGATGCTGTGGAGAAACTCATTAAG
ACGCGTAACCCGGACAAGCAGCTCGTCAGGTGGACTGACTATGAGCGTCTCAATGCTGAGGAGAACCGCCGCGGTGAACTCGTGGGCAAGCCTCGTGAAA
AGATCACGTCCGTTGCGGAAATGCTGGCCGTTGCGAAGAGTGCCAACTGATGATGTTCATCACAATAGAACAGCACGACAGTTTGGGGATATCACACTTA
TCGATAACAAAATACCGTGATGTCTTAGCTTCTAGCGCCATTGCGCTCATTTTGGCGGGTAAGCGCAGCATTGGCAGCTTTCAGCGCGCGATTCTTCTTG
CGCTGCAAGAGTATCACAAACGAAAAACGTACGCGTAAGATTAACCTGATTCATGCGCGTCCGCATCGATGGAGTTACCTATGACGCACCTCTTCTTCCA
ACAGCCTCCTCAGGCGTCGACACTCCACTGAGTCACCACTTTTGTCCTCGTCGTGACTCGCCACGGATGGAGGTCGAACCACATTACTTCTGCTCTCCGG
CCGGCCGTCGAAAACAATTTGCTCGCTATCGTCGACAGCGAATGGGTCAATGAGAGGCTGGTTCACCCGATCTCGAAGAGCTGCTGCGTATGTTGGTTTC
GTTCTTCGCACTGGGGCCGAGAGCGGACGCGCTGGTTTAATCCGGTCCATTACCGACGGAATTGCGACAGCAGAGCGTGGGTGCTGCAAAGGAAGCCGAG
CTGCTGCTGTCGCCATCTATTGACATCAACACTTAGTTTTTCTGCGATGCACAATGACATCTATTCGGCTCGTACAATGGCCTTGACGTGCCGGAGCTTG
GTAGGGTCCGCCAGAATATTTTTTGGCAGTGAAAAGGTTCTGGGGCAGAAAGAAAATACAAGGTTAGTTGCTCTGCGTTCATGAAGGAGAAAAACATTTC
CTTGTACCTTTGGCTTGTATCAACAGCGCTAACTAGCCGCCCAACGTACGTGTACAACTCCAAGCAGTCCTCACGAATGTTCTTAGCACGGACAGTGTTA
GTATGGCGGAACCAGCACCAATACTACATTTCACTCACATCCATTGTCTCCGTCGCGGTCTGCTGCATTTGCTGAAGCTTTGCGTTTGTTTCGTTGAGCT
CTTCCGTCTTGCTTTTCAGAGACTGTTCATACTATTCGAGTGTAGTACATTTAGTAAAGAGCCCGCAGGGGCTACATGATAGCTAGTGTTCCACTCACCT
GCTGTCGGATAAGGGCGATTTCATTCTCTTTTGCCTTTTGCAAGGATGCCACCCGCAGACGAAGTCTCTGCAGAGGATCGAACACCGAGCGTAAGTGACA
TGCTAAGCATTGCATGAAGCAGCTCGCGCATCACCAACCTGTTCGAATTGCTTTTCACGATCCTTTGAGGTCCCGGAAGCGTCTACTGGGTTGATGGTTG
AGGTCGAATACTGCTGGAGAGGGTTCTGGCTGTCTACCCCAACATGCTGCGCTTGGTTATTTCGGCTGAGAAGCGCTTGCATTTCTGCTCGATGTCGTGC
TGCTTCCGATGCCAAAGCGCGCTCATATTCGTTCGCTTTCTGCTGTAAACAGCCTTCCAGCGTGGCGATTCTTCGCTTTTGCTCGTTAATGACTTGCCGC
GCATTCTCCTTATCCTTCTTGGCTTCAGTCTACGAGTAGTAAAAGCAGTAGGATGAGCTGCTAGCGATGTGGTGGGCAGAATTACTAGTCACCCCACTCA
TGTCGTACCACAACTACCGTAAAATTACTCTTCGCATTGTCATACTTTTGTCGTAAGCGATCGCGGTCGGATCTAGCGTTTTCAGCTGGCAAAAATTGCT
TATGAGTAGGAGTGTTGCAGCAGGACATTATCATAAATAAATGTACTCACCGTCAGTTCTCAATAAGCCTTGTACGTGTCCTGTGGGCCCCAGATGCCTT
CTCTTGAGGAATGCACCAGAGGCCGCAAAATGATCGCCTTGGTCTTCATCGGCAAATACTGATTTCAGTACCAGTCCGTCCTACATGCACGCCAACTTTA
AGCCTTCGACGCACCGCAGACTACAAAACAACAGGCTAGAATCACGTACGGCAAATTTGATTTCACCGCTCTCCGAAATCTCTTCGGCCTGGAAACCGAG
CTCGTTTAGTGTGGCGACGAACCTGTTGTTGTACTCGGTGCGCAATCCCTCCAGCTGTCGTCGCAAGATGCTCAGCTCTTCTTGAAGTTTTCGGATACGC
CGATCCTTGTCCGCAATGGTGCCGTTGATGTGATTCACGCGTGGCTGTCCACACCATTCACTGGTTAGTAGTGGCGGACAAAGTGAGCTTTATCTGCAGT
ACTTGCCTGGTTCTGAACTGACCGACAACGGTTAGCAAACTGTAAAGTACCAAGGCACTCTTCGTAGTGCTCTTTCATCGGATGGATCGTGGCAATAAGA
GTAGTAAAACAGTTCCCTCCTGCGAGCCATGTAGCATTATCAGCGCCCAGGAATTAGCTAGTAAGTCAGACTTTTTCGTCGTATACGAACCGATACTATT
CTGCAGAAGACGCGTGAGTTTGGAGTCTCGGTAAGGGATGTAGTTGTAGCCGCTCTCTGGATCCAACGACATGACTACTTTGCCGACTGCACTTAAGCTG
GAGTTAATGTGCAATGCCTCCTTGAGACGCTGACCGTCAGATTCACTTTTCTTTAAGCGCTCAGACCTATGTGAGCATGCATACTGACGTCAATACCTTA
CTCAACAGTTTGGTTTGTAATGATTACAGTACTTACCCCGCGAGGTCAACCATGTTGAGCATCCCGTAGATCACTTCCTCTGTGTCTCGAACTCCAGCAA
TCCAACAAACCAGCACAAGGTTAGACCCCGCAGTCTCAATAGCCGCAAACGTGCACCACTACCTTGCTGAAATACGTGGATCGTGAAAACGGTGTGCGAT
CGAGATGAGACTGCGTTCATTTTGGTTTCGTGCGTCGAGCGAAGTTTCAGCCCGCATTGCACTATGGCATCCACCTCTTCTCTTGACGATACGGTAACCA
TAGACAAGTCCTTCACGAAGACCCTGCCTTGAGCATCCTCATGGATCTCAAAGTTTGCTAGAGCATGTAACCCACAGGTAGTCAAGGCAACCCGTTAGTC
CGAGTACTTGAGGGGGGGGGGGAGGGGGATAATTCGTAGTGCTTGTGTTTCATGCCTTTTTCGTAGTCGTAGTCTTCTTCGATTCGCGGTGGATTCGAGC
TGAAACTGCTCGCAGAACAAACTCAAGATGCGGGGTGAGGGGTTTAACGGTTATCCACACAATCTTAATTGACGCCATACCTTGCAGCACTCTCAGTTCG
AGGAATCTGCTGTTGCTGCTGCTCATTGAAAAACGCATAAAGATTATGATAAACTACACCGCTTTAATCACACGTAGATGAACGACACCTGACGAAGAAA
CCACTCGGCGCTGCTCGACGTCTGATACGAGACTGGTCGTCCAGTTTTCTTGAGGTACCTACGTTTTTAGGCAGTGCAAAGCGAAGTGACAAAGAAAATA
AATATAATATAGGTTGTAAAATTTTCCCAGTGCTCCCTTACGCTCGTGCGAGGTCACGGACTCTATCGCAGTAGATTTCCAGAAAGCTGACGACGAGGGT
CACTTCCTAGTCAATCAAACGCGATGTTATGCTGAAACCCATGTTTATCATCTGTACAGATCTCACACACGCACGCACTTTCGACTTGCTCTGCTGACGG
TTCACCATGTCAAAAAGATACTCGATCGACCGAGAGAGTAGCCCAGCCTTGTCTCCGCCAGGTTCACCAAATATGCTGTGCGCAGAGGTACCGATCAGAA
GTTGGTTATTTTACTCATGTCATTGTGATGCAGCGTCTGAATAGATTCATTGATATACCTGAATGTTTTACCTGAACCGGTTTGTCCGTAGGCGAAGCAG
CAGCTATTGATGCCCTTCAAAGCGTAGTCGACCAAACATTTACTCGTCTAACCATGCATATCGACACAAAAGCTAGTCAGATTACATCAAACGTCATGAA
TGAGCAGCATGACCCGGCTTACCGCTTCGAACAACGTTTCTTGAGTTGTGTCTGTCCAGTAAATCTGTCATAAGACACGATTTGATCAGTGCAAACACCC
GCGGGGGCTATCACAGCATCTTTCTGCCCTACATTGTCGAAGCTAAAGGCGTGGTTTCCGTATTGCATCCGTTCCGTGTCCTAAATGCCCCCAAGGACAA
GCACACAAGCACTTCAGCGACCTCACAAAAATATACAATGAGCTTATCAGACCAGCTTCCCATACCTTGATCACGATATTACTAGGAGTCTCTTTCTTCC
GCTCGAACATGTCTTCGGGGGCGCTTTGACCGTCTGCACAAGGTCTAGCACGAACATACACCTATCGTGATCGAAGTTATGAGCAGTCAGACGCGCATGT
GTAGGCTTGCCATCAAGTTAGGTCGAGGATCTCAAAGCCAACCTTGACGTTGGCATTCCCGAGCAGCCGGGTGTAGTCGGTGGTGACCTTGTGGTCCATG
ATGGAGCGTCCACTCTCTCGTGTCTCGGATCTCTTCCCGACGGCAGGGCGTCTTCGCTGGAGCTCCGAGGAAGTATTTTCAGTAACGTTTCATCGGCTGC
ACGTGCGCCTCTTCATCACACACACACTCGTACGATGGGGCTTACGACGCCGAGCAACTCGGTCGAGTATTTGCATCATGTGCTTGCGCATGTCCAGAAG
CTCAGCGCCCAAGCTTGTGACGAAGGCAACGCCAACAAGCACTTGCAAATTCGAGTTACGCACTGGGTTCGGAAGCTGCGCAGTCAGCCCACATCGAACC
CGACGTGGCTAAAAAGCGTACTTGAGTACGCCGATGTTCTACTTCAAATGCTGCTAGAAGGCGTGCGTGCCTGTGTGAGAATTATGGTTATATTTCCTGT
GCTACAACTGATCCACATCTCATTTCACATCAGGTGATCGAGGAGCCTTTCACGAAAATGCCACCCCAAGGCCCGTTGGCCGCCCTGCCGAGGTATCAGG
TGGGCCCCCAGGGTGTACTCGTACTCCGTTCATCTATAACCACTGGCTGAATGTATTCTCCATTTATTTCTTACGCGCAGGTTGCAAGGCTGGCAAAGAC
AGCTAGACAATTCGTCAGAGTAGCGGCACGACCAACGCAACCCGCAGCAGTTTACCCAGCAAAAGCTCGCCCCCGTACTGGTCACCGCAACAATTCCGAG
AACCAGCGGGTCGTAGCGGTGACTCGAAAGGTGAGCAAGCAGATTCAAACACAAGAGCAAGACGATCAGTGGGAATGGCAGCGCGTCTGGAAAGGTGCTT
TCGACAAAATGCACCTGCAGCTGAAGCAGAAAACAGAGGAGACGGAGGCCCTTGCCACGGAGAACAGGGTACCTCCACTCTTTCACGCCCTCCGAGACCA
ATATGCTTATCGTTGTTGCATCTAACTCGCGTGCGCTCGCAGGAGCTGCGGTCCCTCGTTGCAGGCTACACGAAAGCTCTGGAGGAAGCCGAGCGCAGGC
AACGCGACATCGAGGCCAAGCACCTCGCTGAGATCGAAAACCTCCGCGCCGTGCACTCCTTGGAGCTGTCCAACCTGCAGGCCAAACATCGCCAGAAACT
CCAAGAAGTGGCGCTGCAGAACGACGAAACGTTGATCAGCAGACGTCGAGAGAGTTTCTTGCTTCGACCAGCAGCCAGCTCCGCGGTGCGTACAGTATGG
CGTAGCGTAGATCCCGGTAGTCACCAGTATGTTCTAACGTATATATCGTCACGACAGTCCCAACACGAGGTCGCAGACGCCAACGCCGACTTCCTGCAGT
ACATCGACGCCTTCTACTCGTCCACCCTGCACCTCACGGCCCAGAACAAGGCTTGATTGACAACAAGCTGCTGTACACACGTGGCAGTACCTCAGTTACT
CGAACTCGAACAAAGTATCGAGGCATACAAATTTCAAGAGAAAGTAACGGTTCCCTTGCAACGGTATCATCATTGTGCGATAGAGGCAAGAAGGAGAGAG
GAAGCGCACCATGTCGGCCAAGACCCTGCAGGGAGACCCGCGCCGCCCCGGCGACTTGCACCCGTTCGTGCGCGAGCAGGTGGACCCCGACGACGCGCCC
GGCGACTGGTACGCCTTCTTCTCGCTCGTGCTGGGCTTCCTCGCCTTCACCATGAAGGTATAAGACAGCTACTATGATTATATGCCACGACTGTTATTAC
GGTAGTTGTATTCGCTCAATACTAACGGCGTCGTGTTGCGATATGTAGTGGAAGGAGCTGGCGTGGGGCTCGCTGCTGCTGTGCGTGGGCTCGTTCACCA
ACATGAAGTCGCAGGACATGAACACAACGCAGGTGGCCATGTCCTTCTTCTTCTCCACGAGCGCGCTCGTGTCCGCCTACATGGGCGCCATGCATCCAGG
CATGCCCATGCCCCCGTCGGCCCAATCGGTCCAAGCGCCGGCTTCGTAGACGAGA